Anatomy & Physiology (6th Edition)
6th Edition
ISBN: 9780134156415
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 22.8, Problem 34CYU
Summary Introduction
To review:
The MMC and its importance.
Introduction:
The small intestine is a part of the alimentary canal, which is the site for the complete digestion of food. It has three subdivisions: duodenum, jejunum, and ileum. It performs several functions, such as secretion of enzymes for digestion, regulation of entry of chyme from the stomach, and it also showsmotility. The two motility patterns in the small intestine are the segmentation and the migrating motor complex (MMC).
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups?
Loci
a and b
Percent Recombination
50
a and c
14
a and d
10
a and e
50
a and f
50
b and c
50
b and d
50
b and e
35
b and f
20
c and d
5
c and e
50
c and f
50
d and e
50
d and f
50
18
e and f
Selected Answer:
n6
Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances.
Z
e.g. Linkage group 1=P____5 mu__Q____12 mu
R
38 mu
5 Linkage group 2-X_____3 mu__Y_4 mu
sanight
What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?
Chapter 22 Solutions
Anatomy & Physiology (6th Edition)
Ch. 22.1 - Name one organ of the alimentary canal found in...Ch. 22.1 - Prob. 2CYUCh. 22.1 - Prob. 3CYUCh. 22.2 - How does the location of the visceral peritoneum...Ch. 22.2 - Of the following organs, which is/are...Ch. 22.2 - Name the layers of the alimentary canal from the...Ch. 22.2 - What name is given to the venous portion of the...Ch. 22.2 - Prob. 8CYUCh. 22.3 - Prob. 9CYUCh. 22.3 - The term gut brain does not really mean there is a...
Ch. 22.3 - Jerry has been given a drug that inhibits...Ch. 22.4 - Which structure forms the roof of the mouth?Ch. 22.4 - Besides preparing food for swallowing, the tongue...Ch. 22.4 - Prob. 14CYUCh. 22.4 - Prob. 15CYUCh. 22.5 - To which two organ systems does the pharynx...Ch. 22.5 - How is the muscularis externa of the esophagus...Ch. 22.5 - What is the functional significance of the...Ch. 22.5 - What role does the tongue play in swallowing?Ch. 22.5 - How are the respiratory passages blocked during...Ch. 22.6 - Prob. 21CYUCh. 22.6 - Two substances secreted by cells of the gastric...Ch. 22.6 - Name the three phases of gastric secretion.Ch. 22.6 - How does the presence of food in the small...Ch. 22.7 - What is a portal triad?Ch. 22.7 - What is the importance of the enterohepatic...Ch. 22.7 - Prob. 27CYUCh. 22.7 - What is the makeup of the fluid in the pancreatic...Ch. 22.7 - Prob. 29CYUCh. 22.8 - Prob. 30CYUCh. 22.8 - What are brush border enzymes?Ch. 22.8 - Distension of the stomach and duodenal walls have...Ch. 22.8 - Prob. 33CYUCh. 22.8 - Prob. 34CYUCh. 22.9 - Name and briefly describe the types of motility...Ch. 22.9 - What is the result of stimulation of stretch...Ch. 22.9 - In what ways are enteric bacteria important to our...Ch. 22.10 - Prob. 38CYUCh. 22.10 - Prob. 39CYUCh. 22.11 - Prob. 40CYUCh. 22.11 - Prob. 41CYUCh. 22 - The peritoneal cavity (a) is the same thing as the...Ch. 22 - Prob. 2MCCh. 22 - Prob. 3MCCh. 22 - Carbohydrates are acted on by (a) peptidases,...Ch. 22 - The parasympathetic nervous system influences...Ch. 22 - The digestive juice product containing enzymes...Ch. 22 - Prob. 7MCCh. 22 - Someone has eaten a meal of buttered toast, cream,...Ch. 22 - The site of production of cholecystokinin is (a)...Ch. 22 - Prob. 10MCCh. 22 - The gallbladder (a) produces bile, (b) is attached...Ch. 22 - The sphincter between the stomach and duodenum is...Ch. 22 - The protein molecule will be digested by enzymes...Ch. 22 - The protein molecule must be digested before it...Ch. 22 - The products of protein digestion enter the...Ch. 22 - Before the blood carrying the products of protein...Ch. 22 - Having passed through the regulatory organ...Ch. 22 - Make a simple line drawing of the organs of the...Ch. 22 - Prob. 19SAQCh. 22 - Name the layers of the alimentary canal wall. Note...Ch. 22 - What is a mesentery? Mesocolon? Greater omentum?Ch. 22 - Prob. 22SAQCh. 22 - (a) Describe the boundaries of the oral cavity....Ch. 22 - Prob. 24SAQCh. 22 - Describe the two phases of swallowing, noting the...Ch. 22 - Describe the role of these cells found in gastric...Ch. 22 - Describe the regulation of the cephalic, gastric,...Ch. 22 - (a) What is the relationship between the cystic,...Ch. 22 - Prob. 29SAQCh. 22 - Indicate the function of the stellate macrophages...Ch. 22 - Prob. 31SAQCh. 22 - Prob. 32SAQCh. 22 - Prob. 1CCSCh. 22 - Remember Mr. Gutteman, the gentleman who was...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Principles Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Comprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage Learning
Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning