
The peritoneal cavity (a) is the same thing as the abdominopelvic cavity, (b) is filled with air, (c) like the pleural and pericardial cavities is a potential space containing serous fluid, (d) contains the pancreas and all of the duodenum.

Introduction:
The peritoneal cavity is the largest serosal sac and considered as the largest fluid filled cavity in the body. Most of the intra-abdominal organs are covered by this cavity. The peritoneal cavity is made up of a layer of mesothelium that is supported by thin layer of connective tissue. The peritoneal lining of the cavity performs the function of a channel for blood vessels, lymphatic vessels and nerves of abdominal organs.
Answer to Problem 1MC
Correct answer:
Peritoneal cavity is a potential space containing serous fluid, like pleural and pericardial cavities.
Explanation of Solution
Explanation for correct answer:
The peritoneal cavity is a space that is present between the partial peritoneum and visceral peritoneum. The cavity contains the fluid that consists of water, electrolytes, leukocytes, and antibodies. This fluid acts as a lubricant and permits the free movement of abdominal viscera. It does not contain air or any digestive organs. The pancreas and duodenum are present in the abdominopelvic cavity. Hence option (c) is the correct answer.
Explanation for incorrect answers:
Option (a) states that peritoneal cavity is the same as the abdominopelvic cavity. Abdominopelvic cavity contains the abdominal cavity and pelvic cavity, whereas peritoneal cavity lies between the partial peritoneum and visceral peritoneum. Thus this option is incorrect.
Option (b) states that peritoneal cavity is filled with air, whereas there is no air in this cavity. Thus this option is incorrect.
Option (d) states that peritoneal cavity contains the pancreas and the entire duodenum. Pancreas and duodenum are present in abdominopelvic cavity, not in peritoneal cavity. Thus this option is incorrect.
Thus it is concluded that peritoneal cavity is a space that is present between the partial peritoneum and visceral peritoneum and it consists a serous fluid that contain water, electrolytes, leukocytes, and antibodies.
Want to see more full solutions like this?
Chapter 22 Solutions
Anatomy & Physiology (6th Edition)
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
- Fundamentals of Sectional Anatomy: An Imaging App...BiologyISBN:9781133960867Author:Denise L. LazoPublisher:Cengage LearningHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning


