DRAW IT Below are the amino acid sequences(using the single-letter code; see Figure 5.14) of four short segments of the FOXP2 protein from six Speeles: chimpanzce (Q, orangutan (()), gorllla (G), rhesus macaque (R), mouse (M), and human (H). These segments contain all of the amino acid differences helween the FOXP2 proteinsof these species.
Use a highlighter to color anv amino acid that varies among the species. (Color that amino acid in all sequences.
- (a) The C, G, R sequences are identical. Identily which lines correspond to those sequences.
- (b) The O sequence differs from the C, G, R speieces at two amino acids. Underilnethetwodlffcrences inthe H sequence.
- (c) The O sequence diffen from the C, G, R sequences at one amino acid (having V instead of A) and from the H sequence at three amino acids. Identify tho O sequence.
- (d) In the M sequence,circle the amino acid(s) that differ from the C, G, R sequence, and draw a square around those that differ from the H sequence.
- (e) Primates and rodents diverged between 60 and IO0 million years ago. and chimpanzees and humans about 6 million years ago. Compare the amino acid differences between the mouse and the C, G, R species with those between the human and the C, G, R species. What can you conclude?
Learn your wayIncludes step-by-step video
Chapter 21 Solutions
Campbell Biology (10th Edition)
Additional Science Textbook Solutions
Human Biology: Concepts and Current Issues
Campbell Biology in Focus (2nd Edition)
Campbell Biology: Concepts & Connections (9th Edition)
Laboratory Experiments in Microbiology (12th Edition) (What's New in Microbiology)
Becker's World of the Cell (9th Edition)
- What is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. provide calculationarrow_forwardA hypothetical protein found in humans, chimpanzees, and orangutans has the following sequences. Underlining indicates amino acid residue differences and dashes indicate a deletion. Humans ATSAAGYDEWEGGKYLIHL--KLQNRGALLELDIGAV ATSAAGWDEWEGGKILIHLDGKLQNRGALLELDIGAV ATSAAGWDEWEGGKVLIHLDGKLQNRGALLELDIGAV Chimpanzees Orangutans What is the sequence of the protein present in the last common ancestor of humans and chimpanzees? sequence: ATSAAGWDEWEGGKVLIHILDGKLQNRGALIELDIGAV Incorrect Answerarrow_forwardAlthough the Shine-Dalgarno sequences vary considerably in differ- ent genes, they include examples like GAGGGG that could serve as code-in this case, for Glu-Gly. Does this imply that the sequence Glu-Gly cannot ever occur in a protein, lest it be read as a Shine-Dalgarno sequence? Speculate.arrow_forwardA peptide with 19 amino acid residues was digested with trypsin and generated the following fragments: • GGIR SFLG WAAPK AEEGLR A similar peptide was treated with chymotrypsin and generated the following fragments: • LG AEEGLRW AAPKGGIRSF Elucidate the correct sequence of the peptide.arrow_forwardConsider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?arrow_forwardConsider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.arrow_forwardGiven the genetic code below, enter the correct amino acid sequence for the following RNA sequence: AUG GAG UCC UUG CUG UGA (enter the amino acids as the 3 letter abbreviation on the table separated by dashes with no spaces e.g. Met-Thr-Lys-Glu-Ser) Alanine (Ala) AGUC Tyrosine (Tyr) Valine (Val) GU Cysteine (Cys) START HERE G Arginine (Arg) G Tryptophan (Trp) A C CUGA Serine (Ser) Leucine (Leu) Lysine (Lys) Proline (Pro) Asparagine (Asn) 0406 ACUGACUOROE (na) auone (aug) Giycine (Gly) Serine (Ser) Phenylalanine Glutamic acid (Glu) Aspartic acid (Asp) Histidine (His) Glutamine (Gin) Arginine (Arg) Isoleucine (lle) Methionine (Met) o Threonine (Thr)arrow_forwardProteins called molecular chaperones assist in the process of protein folding. One class of chaperones found in organisms from bacteria to mammals is heat shock protein 90 (Hsp90). All Hsp90 chaperones contain a 10 amino acid “signature sequence” that allows ready identification of these proteins in sequence databases. Two representations of this signature sequence are shown below. (a) In this sequence, which amino acid residues are invariant (conserved across all species)?(b) At which position(s) are amino acids limited to those with positively charged side chains? For each position, which amino acid is more commonly found?(c) At which positions are substitutions restricted to amino acids with negatively charged side chains? For each position, which amino acid predominates?(d) There is one position that can be any amino acid, although one amino acid appears much more often than any other. What position is this, and which amino acid appears most often?arrow_forwardGene editing is also used to explore the structure and function ofproteins. For example, changes can be made to the coding sequenceof a gene to determine how alterations in the amino acid sequenceaffect the function of a protein. Let’s suppose that you areinterested in the functional importance of a particular glutamicacid (an amino acid) within a protein you are studying. By geneediting, you make mutant proteins in which the glutamic acidcodon has been changed to other codons. You then test the encodedmutant proteins for functionality. The results are as follows: FunctionalityNormal protein 100%Mutant proteins containingTyrosine 5%Phenylalanine 3%Aspartic acid 94%Glycine 4%From these results, what would you conclude about the…arrow_forwardA) Based on the mRNA sequence below, provide the corresponding DNA template (5'-3') and protein sequences (N-C terminus) using the single letter abbreviations for each 5' GCA UAU CCU UGU GAU 3' B) Identify the two unique amino acids in the protein sequence above, provide their full names and brief explanation why you chose them C) Draw the two amino acids from 3. connected with a peptide bond to each other (with free amino and carboxy termini) at physiological pH|arrow_forwardA lilP mutant called lilPXS is isolated that produces a truncated polypeptide of only 6 AA in length. Describe a single basepair DNA change that would lead to this truncated version of the protein. Multiple options are possible(100 words maximum)arrow_forwardBased on sequences A,B,C. Provide an anticodon sequence that would build this protein. Sequence ATCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence BTCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACTSequence CTACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTCGCGCCGAAAAAGATATGGarrow_forwardarrow_back_iosSEE MORE QUESTIONSarrow_forward_ios
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning