CAMPBELL BIOLOGY-W/MOD.MASTERBIOLOGY
11th Edition
ISBN: 9780134683461
Author: Urry
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
Chapter 21, Problem 3TYU
Summary Introduction
Introduction: “Gene duplication” is the phenomenon of the occurrence of more than one copy of the genes in the genome of the organisms like the alpha and the beta globin gene family. It takes place in the genome due to the presence of the transposable genes inserted in the chromosomes. This causes the development of the formation of the unequal crossing of the chromosomes.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Sickle cell anemia is a widespread disease in many African countries and can be caused by a
change in the amino acid sequence from glutamic acid to valine. A patient is diagnosed with
the disease and a genetic fingerprint reveals the following DNA sequence for the gene:
(a)
(b)
(c)
(d)
(e)
Write down the mRNA sequence for the given DNA sense strand indicating the
polarity.
Derive the polypeptide from the mRNA molecule using the table of the genetic code
(Table Q1 below) again indicating the polarity of the peptide chain.
Indicate the position in the DNA molecule that could have caused the disease and write
down all possible point mutations in the DNA sequence that could have caused it. [
The polypeptide chain is polymerized at the ribosomes using t-RNA molecules. Write
down all possible t-RNA molecules with their anti-codons that are used to polymerize
the amino acid VAL. Indicate the polarity.
3'-TAC TGA GCA AGA TTA CAT ACT-5'
Explain what is meant by redundancy of the genetic code.…
If the codon AAA is mutated to AAG, it still codes for the amino acid, lysine, and the
protein remains functionally the same; which of the following would best describe
the result of this mutation?
1) frameshift mutation.
O 2) insertion mutation.
O 3) silent mutation.
4)
nonsense mutation.
O 5) back mutation.
If you were to hybridize a eukaryotic gene to its corresponding mRNA, the two molecules would not perfectly align. Why would it not?
A) Exons contained in the gene have been removed from the mRNA via splicing.B) RNA polymerase adds introns to the mRNAC) Introns contained in the gene have been removed from the mRNA via splicing.D) RNA polymerase adds exons to the mRNA
Chapter 21 Solutions
CAMPBELL BIOLOGY-W/MOD.MASTERBIOLOGY
Ch. 21.1 - Describe the whole-genome shotgun approach.Ch. 21.2 - Prob. 1CCCh. 21.2 - Explain the advantage of the systems biology...Ch. 21.2 - MAKE CONNECTIONS The ENCODE pilot project found...Ch. 21.2 - MAKE CONNECTIONS In Concept 20.2, you learned...Ch. 21.3 - The best estimate is that the human genome...Ch. 21.3 - The Genomes Online Database (GOLD) Website of the...Ch. 21.3 - WHAT IF? What evolutionary processes might...Ch. 21.4 - Discuss the characteristics of mammalian genomes...Ch. 21.4 - VISUAL SKILLS Which of the three mechanisms...
Ch. 21.4 - Contrast the organizations of the rRNA gene family...Ch. 21.4 - MAKE CONNECTIONS Assign each DNA segment at the...Ch. 21.5 - Describe three examples of errors in cellular...Ch. 21.5 - Explain how multiple exons might have arisen in...Ch. 21.5 - What are three ways that transposable elements are...Ch. 21.5 - WHAT IF? In 2005, Icelandic scientists reported...Ch. 21 - How did the Human Genome Project result in more...Ch. 21 - What has been the most significant finding of the...Ch. 21 - Compare genome size, gene number, and gene density...Ch. 21 - Explain how the function of transposable elements...Ch. 21 - How could chromosomal rearrangements lead to the...Ch. 21 - What type of Information can be obtained by...Ch. 21 - Bioinformatics intludes all of the following...Ch. 21 - Homeotic genes (A) encode transcription factors...Ch. 21 - Prob. 3TYUCh. 21 - DRAW IT Below are the amino acid sequences(using...Ch. 21 - EVOLUTION CONNECTION Genes important in the...Ch. 21 - scientific inquiry The scientists mapping the SNPs...Ch. 21 - Prob. 7TYUCh. 21 - SYNTHESIZE YOUR KNOWLEDGE Insects have three...
Knowledge Booster
Similar questions
- Which of the following types of enzymes is primarily responsible for setting up the genetic code? 1.) Kinases 2.) DNA ligase 3.) DNA gyrase 4.) peptidyl transferase 5.) aminoacyl tRNA synthetases (charging enzymes)arrow_forwardWhich of the following mutations would be most likely to havea harmful effect on an organism?(A) a deletion of three nucleotides near the middle of a gene(B) a single nucleotide deletion in the middle of an intron(C) a single nucleotide deletion near the end of the codingsequence(D) a single nucleotide insertion downstream of, and close to,the start of the coding sequencearrow_forwardProcess by which the DNA sequences encoding exons are exchanged and reordered through genetic recombination between DNA sequences encoding introns. Group of answer choices a)RNA editing b)Exon Definition c) Exon Shuffling d)Transesterificationarrow_forward
- Transcription and translation are separate processes in gene expression; however, they have similarities. The following terms all relate to translation. Which of these has a role that is most similar to that of the transcription start site during transcription? A)Start codon B)Stop codon C)tRNA D)Amino acidarrow_forwardWhich of the following recognizes the mRNA codon 5' - U A A - 3'?Question 29 options: A) a special termination tRNA B) a special termination amino acid C) a special termination protein D) Kozak's sequence E) aminoacyl tRNA synthetasearrow_forwardChloramphenicol blocks the peptidyl transferase reaction on ribosomes. The specific effect of this compound would be to ... A) inhibit transcription B) prevent peptide bond formation C) block the translocation steps in translation D) prevent entry of aminoacyl TRNAS into the A site E) prevent recognition of the promoter sequences by sigma factorarrow_forward
- a) Examine the nucleotide sequence below, and determine the amino acid sequence encoded by this mRNA. (2) 5' CCUCCGGACCGGAUGCCCGCGGCAGCUGCUGAACCAUGGCCCGCGGGUGAGCCAAGGAGGAGGGC 3' b) What would be the consequence of a mutation that resulted in changing the underlined nucleotide to a G? (2) Second base U G. Consensus sequences functioning in transcription or translation (5-3): UGU UAU UCU Phe UCC Ser UCA Leu UCG UUU Tyr Cys TATA box (-25) TATAAA UUC UAC UGC UAA Stop UGA Stop A UAG Stop UGG Trp G UUA TFIIB recognition element /c/c/¢CGCC UUG TATAAT CGU CAU His CAC Pro CAA Gln CAG -10 (Pribnow) sequence CUU CCU CC Leu CCA CGC Arg CGA CUC TTGACA -35 sequence CỦA CUG CCG CGG Shine-Dalgarno sequence (Ribosome binding site) UAAGGAGGU YYANT/AYY AGU Asn AGC AUU ACU AAU Ser Initiator element AUC lle ACC Thr AAC AGA Lys AGG AUA ACA AAA lA AGLGU ^/G AGU Arg Intron 5' splice site AUG Met ACG AAG CAGIG GGU GAU Asp GAC Intron 3' splice site GCU GUU GCC Val GCA GGC Gly GGA GUC AAUAAA Ala Cleavage site…arrow_forwardGeneticists have found that when they cut out a eukaryotic gene from genomic DNA that they can hybridize one of the strands of that gene to the mRNA for that gene by allowing the strands to hydrogen bond. Why is it sometimes claimed that alternative splicing of exons from a single gene results in a set of proteins of related function?arrow_forwardQ11arrow_forward
- The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect on protein function of most substitution mutations (single-base changes). We will use the six arginine codons to test this idea. Consider all of the substitutions that could affect all of the six arginine codons.(a) How many total mutations are possible?(b) How many of these mutations are “silent,” in the sense that the mutantcodon is changed to another Arg codon?(c) How many of these mutations are conservative, in the sense that an Argcodon is changed to a functionally similar Lys codon?arrow_forward3)Which of the following statements are true? Choose all that apply a)There are multiple codons possible for nearly all amino acids b)Each stop codon also codes for an amino acid c)Each tRNA will base pair with only one codon d)The start codon also codes for an amino acid e)Each codon in mRNA codes for exactly one amino acid f)Each codon in tRNA codes for exactly one amino acid g)Each anticodon in tRNA pairs with exactly one codon h)Each tRNA carries exactly one type of amino acidarrow_forward26) Eukaryotes are unable to couple transcription and translation because: A) the two processes occur in separate regions of the cell B) they do not have the specialized ribosomes that occur in bacteria C) the genetic code in eukaryotes is incompatible with the formation of polyribosomes D) the mRNA of eukaryotes do not have the appropriate spacers that polycistrons allow for polyribosomes to form E) eukaryotic mRNA molecules are monocistronic. asap please.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning