
Nester's Microbiology: A Human Perspective
8th Edition
ISBN: 9780073522593
Author: Denise G. Anderson Lecturer, Sarah Salm, Deborah Allen
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Question
Chapter 21, Problem 2A
Summary Introduction
To review:
The response of a physician to a mother who asks if her daughter can get pneumococcal pneumonia again.
Introduction:
Streptococcus pneumoniae causes pneumococcal pneumonia. This bacterium is spherical shaped, diplococcus, and Gram-positive bacteria. This bacteria contains a thick coat of polysaccharide capsule, which provides virulent property to the cell. A person suffering from pneumococcal pneumonia feels fever, chest pain, cough, and start producing sputum. A person starts feeling upper respiratory congestion and severe chest pain in severe cases.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 21 Solutions
Nester's Microbiology: A Human Perspective
Ch. 21 - Prob. 1SACh. 21 - After you recover from strep throat, can you get...Ch. 21 - Prob. 3SACh. 21 -
4. Why has no vaccine been developed for the...Ch. 21 - Prob. 5SACh. 21 - Prob. 6SACh. 21 - Prob. 7SACh. 21 - Prob. 8SACh. 21 - Why did it take so long to discover the cause of...Ch. 21 - Prob. 10SA
Ch. 21 - The following are all complications of...Ch. 21 - Prob. 2MCCh. 21 - Adenoviral infections and the common cold are both...Ch. 21 - All are true of mycoplasmal pneumonia except a) it...Ch. 21 - All of the following are true of legionellosis...Ch. 21 - Prob. 6MCCh. 21 - Prob. 7MCCh. 21 - In the United States, hantaviruses a) are limited...Ch. 21 - All of the following are true of...Ch. 21 - The disease histoplasmosis a) is caused by an...Ch. 21 - Prob. 1ACh. 21 - Prob. 2ACh. 21 - Prob. 1CTCh. 21 - Prob. 2CT
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Surgical Tech For Surgical Tech Pos CareHealth & NutritionISBN:9781337648868Author:AssociationPublisher:CengageHealth Safety And Nutrition F/Young ChildHealth & NutritionISBN:9781305144767Author:MAROTZPublisher:Cengage
Surgical Tech For Surgical Tech Pos Care
Health & Nutrition
ISBN:9781337648868
Author:Association
Publisher:Cengage
Health Safety And Nutrition F/Young Child
Health & Nutrition
ISBN:9781305144767
Author:MAROTZ
Publisher:Cengage
Complications during Labour and Delivery; Author: FirstCry Parenting;https://www.youtube.com/watch?v=QnCviG4GpYg;License: Standard YouTube License, CC-BY