
To review:
Match the term cardiocytes to the closely related descriptions given below:
1. Vein to the left atrium
2. Covers the outer surface of the heart.
3. Supplies blood to the heart muscle
4. Lines inner surface of the pericardial sac
5. Slow heart rate
6. Cardiac muscle cells
7. The muscular wall of the heart
8. Relaxation phase of the cardiac cycle
9. Vein to the right atrium
10. Contraction phase of the cardiac cycle.
Introduction:
The cells of the heart are known to be more complex as compared to the muscle cells. The functional cells of the heart are labeled as myocytes and these are suggestive of their functions as muscle tissue. The cardiac cycle is basically the performance of the heart from the starting of one heartbeat to the beginning of the next one.

Explanation of Solution
The contractile cells of the heart were known as myocytes which indicates their fundamental character. Every functional cardiac cell present basically incorporates both the neurological and muscular capability. Therefore, the cells are known to be neuromylocytes. The cardiocyte comprises three functional activities, the contractile region comprising of the sarcomere and the sarcoplasmic reticulum which present in the center. Along with this, the neural region is present on the left side which is linked with the electrical stimulation.
Therefore, it can be concluded that the cardiocytes can be correctly matched with cardiac muscle cells.
Want to see more full solutions like this?
Chapter 21 Solutions
ANATOMY & PHYSIOLOGY COMM COLL PHILADELPHIA
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Surgical Tech For Surgical Tech Pos CareHealth & NutritionISBN:9781337648868Author:AssociationPublisher:CengageBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College



