
A.
To determine: The decreased compliance in fibrotic lung disease.
Introduction. The respiratory tract is the long tube that extends from the nose to the lungs. The inner lining of the respiratory tract is lined by mucosa that secrets mucous for easy expansion and contraction of the tube and also to trap the dust and foreign particles in the mucous membrane.
A.

Explanation of Solution
As a person ages the work required for breathing increases as the muscles will have to put more effort intobreathing due to the increased resistance and loss of elasticity in the muscles. With advancing age the flexibility and the elasticity in the muscles decrease due to which the individual’s body feels more rigid which requires more effort and so he/she becomes more exhausted in routine activities. This also takes place in case of fibrotic disease where scarring of lung tissue and decreases the gaseous exchange capacity. The fibrosis prevents the gaseous exchange in individuals and exerts pressure on lungs thereby decreasing lung capacities.
B.
To determine: The increased airway resistance in emphysema.
Introduction: The partial pressure of carbon dioxide determines the pH of the body tissues as it is circulated through the blood to all the body tissues and is exchanged with oxygen. The body tissues have high partial pressure of carbon dioxide due to anaerobic respiration and low partial pressure of oxygen which helps to exchange carbon dioxide and oxygen.
B.

Explanation of Solution
Emphysema is a lung disorder that leads to shortness of breath. In people with emphysema, the air sacs or alveoli in the lungs are damaged. Over time, the inner walls of the air sacs weaken and rupture creating larger air spaces instead of many small ones. The increase in the spaces between the alveoli hampers with the gaseous exchange and decreases lung compliance. The loss of alveolar space causes an increase in airway resistance and prevents oxygen and carbon dioxide from diffusing in the alveolar spaces easily.
Want to see more full solutions like this?
Chapter 21 Solutions
EBK ESSENTIALS OF PATHOPHYSIOLOGY
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





