Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 21, Problem 15EQ
Summary Introduction
To analyze:
The oligonucleotide sequence for the given DNA (deoxyribonucleic acid) sequence.
5’- GCCCCCGATCTACATCATTACGGCGAT -3’
3’- CGGGGGCTAGAT GTAGTAATGCCGCTA -5’
Introduction:
The production of the cloned segment of the DNA (deoxyribonucleic acid) that is mutated at a single site is termed as site-directed mutagenesis. The effect of a mutation can be observed on the organism. The nitrogen bases of the DNA that encode the information about the polypeptide or protein synthesis are mutated by using the changes in oligonucleotide sequence.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
The Sentinel Cell: Nature’s Answer to Cancer?
Molecular Biology Question
You are working to characterize a novel protein in mice. Analysis shows that high levels of the primary transcript that codes for this protein are found in tissue from the brain, muscle, liver, and pancreas. However, an antibody that recognizes the C-terminal portion of the protein indicates that the protein is present in brain, muscle, and liver, but not in the pancreas. What is the most likely explanation for this result?
Molecular Biology
Explain/discuss how “slow stop” and “quick/fast stop” mutants wereused to identify different protein involved in DNA replication in E. coli.
Chapter 21 Solutions
Genetics: Analysis and Principles
Ch. 21.1 - 1. Which of the following may be used as a vector...Ch. 21.1 - The restriction enzymes used in gene-cloning...Ch. 21.1 - 3. Which is the proper order of the following...Ch. 21.1 - 4. The function of reverse transcriptase is...Ch. 21.1 - A collection of recombinant vectors that carry...Ch. 21.2 - Prob. 1COMQCh. 21.2 - Prob. 2COMQCh. 21.2 - 3. During real-time PCR, the synthesis of PCR...Ch. 21.3 - When a dideoxyribonucleotide is incorporated into...Ch. 21.4 - 1. The purpose of site-directed mutagenesis and...
Ch. 21.5 - Which of the following methods use(s) a labeled...Ch. 21.5 - 2. Which of the following methods is used to...Ch. 21.5 - During Western blotting, the primary antibody...Ch. 21.6 - 1. In an EMSA, the binding of a protein to...Ch. 21.6 - The basis for DNase I footprinting is that the...Ch. 21 - Discuss three important advances that have...Ch. 21 - Prob. 2CONQCh. 21 - Write a double-stranded DNA sequence that is 20...Ch. 21 - What is cDNA? In eukaryotes, how does cDNA differ...Ch. 21 - 5. Draw the structural feature of a...Ch. 21 - Prob. 1EQCh. 21 - Prob. 2EQCh. 21 - Describe the important features of cloning...Ch. 21 - 4. How does gene cloning produce many copies of a...Ch. 21 - Prob. 5EQCh. 21 - Prob. 6EQCh. 21 - Prob. 7EQCh. 21 - Prob. 8EQCh. 21 - Prob. 9EQCh. 21 - Starting with a sample of RNA that contains the...Ch. 21 - 11. What type of probe is used for real-time PCR?...Ch. 21 - 12. What phase of PCR (exponential, linear, or...Ch. 21 - 13. DNA sequencing can help us to identify...Ch. 21 - A sample of DNA was subjected to automated DNA...Ch. 21 - Prob. 15EQCh. 21 - Prob. 16EQCh. 21 - Prob. 17EQCh. 21 - Prob. 18EQCh. 21 - Prob. 19EQCh. 21 - What is the purpose of a Northern blotting...Ch. 21 - Prob. 21EQCh. 21 - Prob. 22EQCh. 21 - 23. In the Western blot shown here, proteins were...Ch. 21 - If you wanted to know if a protein was made during...Ch. 21 - Prob. 25EQCh. 21 - Prob. 26EQCh. 21 - Prob. 27EQCh. 21 - 28. Describe the rationale behind the...Ch. 21 - Certain hormones, such as epinephrine, can...Ch. 21 - An electrophoretic mobility shift assay can be...Ch. 21 - Prob. 31EQCh. 21 - Prob. 32EQCh. 21 - Prob. 33EQCh. 21 - Prob. 1QSDC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Molecular Biology Question A gene that codes for a protein was removed from a eukaryotic cell and inserted into a prokaryotic cell. Although the gene was successfully transcribed and translated, it produced a different protein than it produced in the eukaryotic cell. What is the most likely explanation?arrow_forwardMolecular Biology LIST three characteristics of origins of replicationarrow_forwardMolecular Biology Question Please help. Thank you For E coli DNA polymerase III, give the structure and function of the b-clamp sub-complex. Describe how the structure of this sub-complex is important for it’s function.arrow_forward
- Molecular Biology LIST three characteristics of DNA Polymerasesarrow_forwardMolecular Biology RNA polymerase core enzyme structure contains what subunits? To form holo enzyme, sigma factor is added to core. What is the name of the structure formed? Give the detailed structure of sigma factor and the function of eachdomain. Please help. Thank youarrow_forwardMolecular Biology You have a single bacterial cell whose DNA is labelled with radioactiveC14. After 5 rounds of cell division, how may cells will contain radioactive DNA? Please help. Thank youarrow_forward
- 1. Explain the structure and properties of atoms and chemical bonds (especially how they relate to DNA and proteins). Also add some pictures.arrow_forward1. In the Sentinel Cell DNA integrity is preserved through nanoscopic helicase-coordinated repair, while lipids in the membrane are fortified to resist environmental mutagens. also provide pictures for this question.arrow_forwardExplain the structure and properties of atoms and chemical bonds (especially how they relate to DNA and proteins). Also add some pictures.arrow_forward
- In the Sentinel Cell DNA integrity is preserved through nanoscopic helicase-coordinated repair, while lipids in the membrane are fortified to resist environmental mutagens. also provide pictures for this question.arrow_forward1. Explain how genetic information is stored, copied, transferred, and expressed. Also add some pictures for this question.arrow_forward!. Describe biological macromolecules (DNA, RNA, proteins, lipids, etc.) and how they function in the cell. also provide some images for this question.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License