
Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 21, Problem 15EQ
Summary Introduction
To analyze:
The oligonucleotide sequence for the given DNA (deoxyribonucleic acid) sequence.
5’- GCCCCCGATCTACATCATTACGGCGAT -3’
3’- CGGGGGCTAGAT GTAGTAATGCCGCTA -5’
Introduction:
The production of the cloned segment of the DNA (deoxyribonucleic acid) that is mutated at a single site is termed as site-directed mutagenesis. The effect of a mutation can be observed on the organism. The nitrogen bases of the DNA that encode the information about the polypeptide or protein synthesis are mutated by using the changes in oligonucleotide sequence.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Which of the following is NOT an example of passive immunization?
A.
Administration of tetanus toxoid
B.
Administration of hepatitis B immunoglobulin
C.
Administration of rabies immunoglobulin
D.
Transfer of antibodies via plasma therapy
Transcription and Translation
1. What is the main function of transcription and translation? (2
marks)
2. How is transcription different in eukaryotic and prokaryotic
cells? (2 marks)
3. Explain the difference between pre-mRNA and post-transcript
mRNA. (2 marks)
4. What is the function of the following: (4 marks)
i. the cap
ii. spliceosome
iii. Poly A tail
iv. termination sequence
5. What are advantages to the wobble feature of the genetic
code? (2 marks)
6. Explain the difference between the: (3 marks)
i. A site & P site
ii. codon & anticodon
iii. gene expression and gene regulation
7. Explain how the stop codon allows for termination. (1 mark)
8. In your own words, summarize the process of translation. (2
marks)
In this activity you will research performance enhancers that affect the
endocrine system or nervous system. You will submit a 1 page paper on one
performance enhancer of your choice. Be sure to include:
the specific reason for use
the alleged results on improving performance
how it works
how it affect homeostasis and improves performance
any side-effects of this substance
Chapter 21 Solutions
Genetics: Analysis and Principles
Ch. 21.1 - 1. Which of the following may be used as a vector...Ch. 21.1 - The restriction enzymes used in gene-cloning...Ch. 21.1 - 3. Which is the proper order of the following...Ch. 21.1 - 4. The function of reverse transcriptase is...Ch. 21.1 - A collection of recombinant vectors that carry...Ch. 21.2 - Prob. 1COMQCh. 21.2 - Prob. 2COMQCh. 21.2 - 3. During real-time PCR, the synthesis of PCR...Ch. 21.3 - When a dideoxyribonucleotide is incorporated into...Ch. 21.4 - 1. The purpose of site-directed mutagenesis and...
Ch. 21.5 - Which of the following methods use(s) a labeled...Ch. 21.5 - 2. Which of the following methods is used to...Ch. 21.5 - During Western blotting, the primary antibody...Ch. 21.6 - 1. In an EMSA, the binding of a protein to...Ch. 21.6 - The basis for DNase I footprinting is that the...Ch. 21 - Discuss three important advances that have...Ch. 21 - Prob. 2CONQCh. 21 - Write a double-stranded DNA sequence that is 20...Ch. 21 - What is cDNA? In eukaryotes, how does cDNA differ...Ch. 21 - 5. Draw the structural feature of a...Ch. 21 - Prob. 1EQCh. 21 - Prob. 2EQCh. 21 - Describe the important features of cloning...Ch. 21 - 4. How does gene cloning produce many copies of a...Ch. 21 - Prob. 5EQCh. 21 - Prob. 6EQCh. 21 - Prob. 7EQCh. 21 - Prob. 8EQCh. 21 - Prob. 9EQCh. 21 - Starting with a sample of RNA that contains the...Ch. 21 - 11. What type of probe is used for real-time PCR?...Ch. 21 - 12. What phase of PCR (exponential, linear, or...Ch. 21 - 13. DNA sequencing can help us to identify...Ch. 21 - A sample of DNA was subjected to automated DNA...Ch. 21 - Prob. 15EQCh. 21 - Prob. 16EQCh. 21 - Prob. 17EQCh. 21 - Prob. 18EQCh. 21 - Prob. 19EQCh. 21 - What is the purpose of a Northern blotting...Ch. 21 - Prob. 21EQCh. 21 - Prob. 22EQCh. 21 - 23. In the Western blot shown here, proteins were...Ch. 21 - If you wanted to know if a protein was made during...Ch. 21 - Prob. 25EQCh. 21 - Prob. 26EQCh. 21 - Prob. 27EQCh. 21 - 28. Describe the rationale behind the...Ch. 21 - Certain hormones, such as epinephrine, can...Ch. 21 - An electrophoretic mobility shift assay can be...Ch. 21 - Prob. 31EQCh. 21 - Prob. 32EQCh. 21 - Prob. 33EQCh. 21 - Prob. 1QSDC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Neurons and Reflexes 1. Describe the function of the: a) dendrite b) axon c) cell body d) myelin sheath e) nodes of Ranvier f) Schwann cells g) motor neuron, interneuron and sensory neuron 2. List some simple reflexes. Explain why babies are born with simple reflexes. What are they and why are they necessary. 3. Explain why you only feel pain after a few seconds when you touch something very hot but you have already pulled your hand away. 4. What part of the brain receives sensory information? What part of the brain directs you to move your hand away? 5. In your own words describe how the axon fires.arrow_forwardMutations Here is your template DNA strand: CTT TTA TAG TAG ATA CCA CAA AGG 1. Write out the complementary mRNA that matches the DNA above. 2. Write the anticodons and the amino acid sequence. 3. Change the nucleotide in position #15 to C. 4. What type of mutation is this? 5. Repeat steps 1 & 2. 6. How has this change affected the amino acid sequence? 7. Now remove nucleotides 13 through 15. 8. Repeat steps 1 & 2. 9. What type of mutation is this? 0. Do all mutations result in a change in the amino acid sequence? 1. Are all mutations considered bad? 2. The above sequence codes for a genetic disorder called cystic fibrosis (CF). 3. When A is changed to G in position #15, the person does not have CF. When T is changed to C in position #14, the person has the disorder. How could this have originated?arrow_forwardhoose a scientist(s) and research their contribution to our derstanding of DNA structure or replication. Write a one page port and include: their research where they studied and the time period in which they worked their experiments and results the contribution to our understanding of DNA cientists Watson & Crickarrow_forward
- hoose a scientist(s) and research their contribution to our derstanding of DNA structure or replication. Write a one page port and include: their research where they studied and the time period in which they worked their experiments and results the contribution to our understanding of DNA cientists Watson & Crickarrow_forward7. Aerobic respiration of a protein that breaks down into 12 molecules of malic acid. Assume there is no other carbon source and no acetyl-CoA. NADH FADH2 OP ATP SLP ATP Total ATP Show your work using dimensional analysis here: 3arrow_forwardFor each of the following problems calculate the following: (Week 6-3 Video with 6-1 and 6-2) Consult the total catabolic pathways on the last page as a reference for the following questions. A. How much NADH and FADH2 is produced and fed into the electron transport chain (If any)? B. How much ATP is made from oxidative phosphorylation (OP), if any? Feed the NADH and FADH2 into the electron transport chain: 3ATP/NADH, 2ATP/FADH2 C. How much ATP is made by substrate level phosphorylation (SLP)? D. How much total ATP is made? Add the SLP and OP together. 1. Aerobic respiration using 0.5 mole of glucose? NADH FADH2 OP ATP SLP ATP Total ATP Show your work using dimensional analysis here:arrow_forward
- Aerobic respiration of one lipid molecule. The lipid is composed of one glycerol molecule connected to two fatty acid tails. One fatty acid is 12 carbons long and the other fatty acid is 18 carbons long in the figure below. Use the information below to determine how much ATP will be produced from the glycerol part of the lipid. Then, in part B, determine how much ATP is produced from the 2 fatty acids of the lipid. Finally put the NADH and ATP yields together from the glycerol and fatty acids (part A and B) to determine your total number of ATP produced per lipid. Assume no other carbon source is available. 18 carbons fatty acids 12 carbons glycerol . Glycerol is broken down to glyceraldehyde 3-phosphate, a glycolysis intermediate via the following pathway shown in the figure below. Notice this process costs one ATP but generates one FADH2. Continue generating ATP with glyceraldehyde-3-phosphate using the standard pathway and aerobic respiration. glycerol glycerol-3- phosphate…arrow_forwardDon't copy the other answerarrow_forward4. Aerobic respiration of 5 mM acetate solution. Assume no other carbon source and that acetate is equivalent to acetyl-CoA. NADH FADH2 OP ATP SLP ATP Total ATP Show your work using dimensional analysis here: 5. Aerobic respiration of 2 mM alpha-ketoglutaric acid solution. Assume no other carbon source. NADH FADH2 OP ATP Show your work using dimensional analysis here: SLP ATP Total ATParrow_forward
- Biology You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?arrow_forwardWrite the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.arrow_forwardAwnser these Discussion Questions Answer these discussion questions and submit them as part of your lab report. Part A: The Effect of Temperature on Enzyme Activity Graph the volume of oxygen produced against the temperature of the solution. How is the oxygen production in 30 seconds related to the rate of the reaction? At what temperature is the rate of reaction the highest? Lowest? Explain. Why might the enzyme activity decrease at very high temperatures? Why might a high fever be dangerous to humans? What is the optimal temperature for enzymes in the human body? Part B: The Effect of pH on Enzyme Activity Graph the volume of oxygen produced against the pH of the solution. At what pH is the rate of reaction the highest? Lowest? Explain. Why does changing the pH affect the enzyme activity? Research the enzyme catalase. What is its function in the human body? What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License