
Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 21, Problem 15EQ
Summary Introduction
To analyze:
The oligonucleotide sequence for the given DNA (deoxyribonucleic acid) sequence.
5’- GCCCCCGATCTACATCATTACGGCGAT -3’
3’- CGGGGGCTAGAT GTAGTAATGCCGCTA -5’
Introduction:
The production of the cloned segment of the DNA (deoxyribonucleic acid) that is mutated at a single site is termed as site-directed mutagenesis. The effect of a mutation can be observed on the organism. The nitrogen bases of the DNA that encode the information about the polypeptide or protein synthesis are mutated by using the changes in oligonucleotide sequence.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Ch.23
How is Salmonella able to cross from the intestines into the blood?
A. it is so small that it can squeeze between intestinal cells
B. it secretes a toxin that induces its uptake into intestinal epithelial cells
C. it secretes enzymes that create perforations in the intestine
D. it can get into the blood only if the bacteria are deposited directly there, that is, through a puncture
—
Which virus is associated with liver cancer?
A. hepatitis A
B. hepatitis B
C. hepatitis C
D. both hepatitis B and C
—
explain your answer thoroughly
Ch.21
What causes patients infected with the yellow fever virus to turn yellow (jaundice)?
A. low blood pressure and anemia
B. excess leukocytes
C. alteration of skin pigments
D. liver damage in final stage of disease
—
What is the advantage for malarial parasites to grow and replicate in red blood cells?
A. able to spread quickly
B. able to avoid immune detection
C. low oxygen environment for growth
D. cooler area of the body for growth
—
Which microbe does not live part of its lifecycle outside humans?
A. Toxoplasma gondii
B. Cytomegalovirus
C. Francisella tularensis
D. Plasmodium falciparum
—
explain your answer thoroughly
Ch.22
Streptococcus pneumoniae has a capsule to protect it from killing by alveolar macrophages, which kill bacteria by…
A. cytokines
B. antibodies
C. complement
D. phagocytosis
—
What fact about the influenza virus allows the dramatic antigenic shift that generates novel strains?
A. very large size
B. enveloped
C. segmented genome
D. over 100 genes
—
explain your answer thoroughly
Chapter 21 Solutions
Genetics: Analysis and Principles
Ch. 21.1 - 1. Which of the following may be used as a vector...Ch. 21.1 - The restriction enzymes used in gene-cloning...Ch. 21.1 - 3. Which is the proper order of the following...Ch. 21.1 - 4. The function of reverse transcriptase is...Ch. 21.1 - A collection of recombinant vectors that carry...Ch. 21.2 - Prob. 1COMQCh. 21.2 - Prob. 2COMQCh. 21.2 - 3. During real-time PCR, the synthesis of PCR...Ch. 21.3 - When a dideoxyribonucleotide is incorporated into...Ch. 21.4 - 1. The purpose of site-directed mutagenesis and...
Ch. 21.5 - Which of the following methods use(s) a labeled...Ch. 21.5 - 2. Which of the following methods is used to...Ch. 21.5 - During Western blotting, the primary antibody...Ch. 21.6 - 1. In an EMSA, the binding of a protein to...Ch. 21.6 - The basis for DNase I footprinting is that the...Ch. 21 - Discuss three important advances that have...Ch. 21 - Prob. 2CONQCh. 21 - Write a double-stranded DNA sequence that is 20...Ch. 21 - What is cDNA? In eukaryotes, how does cDNA differ...Ch. 21 - 5. Draw the structural feature of a...Ch. 21 - Prob. 1EQCh. 21 - Prob. 2EQCh. 21 - Describe the important features of cloning...Ch. 21 - 4. How does gene cloning produce many copies of a...Ch. 21 - Prob. 5EQCh. 21 - Prob. 6EQCh. 21 - Prob. 7EQCh. 21 - Prob. 8EQCh. 21 - Prob. 9EQCh. 21 - Starting with a sample of RNA that contains the...Ch. 21 - 11. What type of probe is used for real-time PCR?...Ch. 21 - 12. What phase of PCR (exponential, linear, or...Ch. 21 - 13. DNA sequencing can help us to identify...Ch. 21 - A sample of DNA was subjected to automated DNA...Ch. 21 - Prob. 15EQCh. 21 - Prob. 16EQCh. 21 - Prob. 17EQCh. 21 - Prob. 18EQCh. 21 - Prob. 19EQCh. 21 - What is the purpose of a Northern blotting...Ch. 21 - Prob. 21EQCh. 21 - Prob. 22EQCh. 21 - 23. In the Western blot shown here, proteins were...Ch. 21 - If you wanted to know if a protein was made during...Ch. 21 - Prob. 25EQCh. 21 - Prob. 26EQCh. 21 - Prob. 27EQCh. 21 - 28. Describe the rationale behind the...Ch. 21 - Certain hormones, such as epinephrine, can...Ch. 21 - An electrophoretic mobility shift assay can be...Ch. 21 - Prob. 31EQCh. 21 - Prob. 32EQCh. 21 - Prob. 33EQCh. 21 - Prob. 1QSDC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What is this?arrow_forwardMolecular Biology A-C components of the question are corresponding to attached image labeled 1. D component of the question is corresponding to attached image labeled 2. For a eukaryotic mRNA, the sequences is as follows where AUGrepresents the start codon, the yellow is the Kozak sequence and (XXX) just represents any codonfor an amino acid (no stop codons here). G-cap and polyA tail are not shown A. How long is the peptide produced?B. What is the function (a sentence) of the UAA highlighted in blue?C. If the sequence highlighted in blue were changed from UAA to UAG, how would that affecttranslation? D. (1) The sequence highlighted in yellow above is moved to a new position indicated below. Howwould that affect translation? (2) How long would be the protein produced from this new mRNA? Thank youarrow_forwardMolecular Biology Question Explain why the cell doesn’t need 61 tRNAs (one for each codon). Please help. Thank youarrow_forward
- Molecular Biology You discover a disease causing mutation (indicated by the arrow) that alters splicing of its mRNA. This mutation (a base substitution in the splicing sequence) eliminates a 3’ splice site resulting in the inclusion of the second intron (I2) in the final mRNA. We are going to pretend that this intron is short having only 15 nucleotides (most introns are much longer so this is just to make things simple) with the following sequence shown below in bold. The ( ) indicate the reading frames in the exons; the included intron 2 sequences are in bold. A. Would you expected this change to be harmful? ExplainB. If you were to do gene therapy to fix this problem, briefly explain what type of gene therapy youwould use to correct this. Please help. Thank youarrow_forwardMolecular Biology Question Please help. Thank you Explain what is meant by the term “defective virus.” Explain how a defective virus is able to replicate.arrow_forwardMolecular Biology Explain why changing the codon GGG to GGA should not be harmful. Please help . Thank youarrow_forward
- Stage Percent Time in Hours Interphase .60 14.4 Prophase .20 4.8 Metaphase .10 2.4 Anaphase .06 1.44 Telophase .03 .72 Cytukinesis .01 .24 Can you summarize the results in the chart and explain which phases are faster and why the slower ones are slow?arrow_forwardCan you circle a cell in the different stages of mitosis? 1.prophase 2.metaphase 3.anaphase 4.telophase 5.cytokinesisarrow_forwardWhich microbe does not live part of its lifecycle outside humans? A. Toxoplasma gondii B. Cytomegalovirus C. Francisella tularensis D. Plasmodium falciparum explain your answer thoroughly.arrow_forward
- Select all of the following that the ablation (knockout) or ectopoic expression (gain of function) of Hox can contribute to. Another set of wings in the fruit fly, duplication of fingernails, ectopic ears in mice, excess feathers in duck/quail chimeras, and homeosis of segment 2 to jaw in Hox2a mutantsarrow_forwardSelect all of the following that changes in the MC1R gene can lead to: Changes in spots/stripes in lizards, changes in coat coloration in mice, ectopic ear formation in Siberian hamsters, and red hair in humansarrow_forwardPleiotropic genes are genes that (blank) Cause a swapping of organs/structures, are the result of duplicated sets of chromosomes, never produce protein products, and have more than one purpose/functionarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License