
Microbiology Fundamentals: A Clinical Approach
3rd Edition
ISBN: 9781259709227
Author: Marjorie Kelly Cowan Professor, Heidi Smith
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Question
Chapter 21, Problem 14Q
Summary Introduction
To determine:
The reason that why many infections mentioned in the chapter make the host more vulnerable to HIV.
Introduction:
The human immumodeficiency virus is a lentivirus which is a causative agent of HIV/AIDS. This HIV virus attacks on T-cells, which provide immunity against the infection that results the loss of the immunity and individual get susceptible to the virus. The HIV virus consists outer envelope on which glycoprotein spikes are present.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 21 Solutions
Microbiology Fundamentals: A Clinical Approach
Ch. 21.1 - Prob. 1AYPCh. 21.1 - Prob. 2AYPCh. 21.2 - Prob. 3AYPCh. 21.3 - List the possible causative agents, modes of...Ch. 21.3 - Discuss important features of leptospirosis.Ch. 21.3 - Prob. 1NPCh. 21.3 - Medical Moment Cranberry versus UTI It has long...Ch. 21.4 - List the possible causative agents, modes of...Ch. 21.4 - Prob. 7AYPCh. 21.4 - Prob. 8AYP
Ch. 21.4 - Prob. 9AYPCh. 21.4 - Prob. 10AYPCh. 21.4 - Prob. 11AYPCh. 21.4 - Prob. 12AYPCh. 21.4 - Prob. 2NPCh. 21.4 - Prob. 3NPCh. 21.4 - Prob. 2MMCh. 21 - Prob. 1QCh. 21 - Some of the E. coli strains that are normal biota...Ch. 21 - Many STIs are asymptomatic, or remain latent for...Ch. 21 - Prob. 4QCh. 21 - Three microorganisms in this chapter can be...Ch. 21 - Prob. 6QCh. 21 - Prob. 7QCh. 21 - Prob. 8QCh. 21 - Prob. 9QCh. 21 - Prob. 10QCh. 21 - Prob. 11QCh. 21 - Prob. 12QCh. 21 - Prob. 13QCh. 21 - Prob. 14QCh. 21 - Prob. 15QCh. 21 - Prob. 16QCh. 21 - Prob. 17QCh. 21 - Prob. 18QCh. 21 - Prob. 19QCh. 21 - Prob. 20QCh. 21 - Prob. 21QCh. 21 - Prob. 1VC
Knowledge Booster
Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningMedical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage LearningUnderstanding Health Insurance: A Guide to Billin...Health & NutritionISBN:9781337679480Author:GREENPublisher:Cengage

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning
Understanding Health Insurance: A Guide to Billin...
Health & Nutrition
ISBN:9781337679480
Author:GREEN
Publisher:Cengage