
Human Anatomy & Physiology, Books a la Carte Edition (2nd Edition)
2nd Edition
ISBN: 9780134754239
Author: Erin C. Amerman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 20.4, Problem 4QC
Summary Introduction
To review:
The difference between the TH and other immune cells. Also, give their function.
Introduction:
T cells are also termed as lymphocytes produced in the thymus that are highly useful in developing immunity in the human body. T cells react with MHC (major histocompatibility complex) molecules in three different stages known as activation, clonal selection, and differentiation.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
7. Aerobic respiration of a protein that breaks down into 12 molecules of malic acid. Assume there is no
other carbon source and no acetyl-CoA.
NADH
FADH2
OP ATP
SLP ATP
Total ATP
Show your work using dimensional analysis here:
3
For each of the following problems calculate the following: (Week 6-3 Video with 6-1 and 6-2)
Consult the total catabolic pathways on the last page as a reference for the following questions.
A. How much NADH and FADH2 is produced and fed into the electron transport chain (If any)?
B. How much ATP is made from oxidative phosphorylation (OP), if any? Feed the NADH and FADH2 into the
electron transport chain: 3ATP/NADH, 2ATP/FADH2
C. How much ATP is made by substrate level phosphorylation (SLP)?
D. How much total ATP is made? Add the SLP and OP together.
1. Aerobic respiration using 0.5 mole of glucose?
NADH
FADH2
OP ATP
SLP ATP
Total ATP
Show your work using dimensional analysis here:
Aerobic respiration of one lipid molecule. The lipid is composed of one glycerol molecule connected to two
fatty acid tails. One fatty acid is 12 carbons long and the other fatty acid is 18 carbons long in the figure
below. Use the information below to determine how much ATP will be produced from the glycerol part of
the lipid. Then, in part B, determine how much ATP is produced from the 2 fatty acids of the lipid. Finally
put the NADH and ATP yields together from the glycerol and fatty acids (part A and B) to determine your
total number of ATP produced per lipid. Assume no other carbon source is available.
18 carbons
fatty acids
12 carbons
glycerol
. Glycerol is broken down to glyceraldehyde 3-phosphate, a glycolysis intermediate via the following
pathway shown in the figure below. Notice this process costs one ATP but generates one FADH2. Continue
generating ATP with glyceraldehyde-3-phosphate using the standard pathway and aerobic respiration.
glycerol
glycerol-3-
phosphate…
Chapter 20 Solutions
Human Anatomy & Physiology, Books a la Carte Edition (2nd Edition)
Ch. 20.1 - What are the main functions of the lymphatic...Ch. 20.1 - 2. How do lymphatic capillaries differ from blood...Ch. 20.1 - What is the pathway of lymph flow from the right...Ch. 20.1 - 4. What main cell types are located in lymphoid...Ch. 20.1 - List the main functions of MALT, lymph nodes, the...Ch. 20.2 - 1. How do innate immunity and adaptive immunity...Ch. 20.2 - 2. What are the three lines of defense?
Ch. 20.2 - What are the bodys main surface barriers, and how...Ch. 20.2 - Prob. 4QCCh. 20.2 - How are the immune system and lymphatic system...
Ch. 20.3 - Match the following cell types with their correct...Ch. 20.3 - Which of the cells in question 1 do not directly...Ch. 20.3 - What is the complement system, and what are its...Ch. 20.3 - In what two ways is the complement system...Ch. 20.3 - 5. What are the main cytokines of innate...Ch. 20.3 - What are the four cardinal signs of inflammation?Ch. 20.3 - 7. What are inflammatory mediators, and what do...Ch. 20.3 - Explain the role of phagocytes in the inflammatory...Ch. 20.3 - What causes the elevated temperature and common...Ch. 20.3 - Prob. 10QCCh. 20.4 - 1. What are MHC molecules?
Ch. 20.4 - 2. How do class I and class II MHC molecules...Ch. 20.4 - How are T cells activated?Ch. 20.4 - Prob. 4QCCh. 20.4 - What are the main functions of TC cells?Ch. 20.4 - Prob. 6QCCh. 20.4 - Prob. 7QCCh. 20.5 - 1. How is a B cell activated?
Ch. 20.5 - Prob. 2QCCh. 20.5 - What are the five classes of antibody, and how do...Ch. 20.5 - 4. List the five main functions of antibodies.
Ch. 20.5 - How do the primary and secondary immune responses...Ch. 20.5 - 6. What is the purpose of a vaccination, and what...Ch. 20.5 - 7. How do active immunity and passive immunity...Ch. 20.6 - How do innate immunity and adaptive immunity work...Ch. 20.6 - Walk through the basic steps of the immune...Ch. 20.6 - How does the immune system survey the body for...Ch. 20.6 - Walk through the steps of the immune response to...Ch. 20.6 - Prob. 5QCCh. 20.6 - 6. How do cancer cells escape the immune response...Ch. 20.7 - Define the four types of hypersensitivity...Ch. 20.7 - Explain how type IV hypersensitivity differs from...Ch. 20.7 - How do primary and secondary immunodeficiency...Ch. 20.7 - Prob. 4QCCh. 20.7 - What is an autoimmune disorder? What produces the...Ch. 20.7 - 6. What are the potential causes of autoimmune...Ch. 20 - 1. Which of the following is not a function of the...Ch. 20 - Mark the following statements as true or false. If...Ch. 20 - Fill in the blanks: The lymphoid organ that...Ch. 20 - Fill in the blanks: Nonspecific immunity is also...Ch. 20 -
5. Which of the following make up the body’s...Ch. 20 - Which of the following does not describe the...Ch. 20 - Mark the following statements as true or false. If...Ch. 20 - Which of the following functions is/are performed...Ch. 20 - Prob. 9CYRCh. 20 - 10. When naïve B cells are activated, they...Ch. 20 - 11. Match the following antibodies with the...Ch. 20 - Mark the following statements as true or false. If...Ch. 20 - Prob. 13CYRCh. 20 - On which type(s) of cells are class I MHC...Ch. 20 - Fill in the blanks: Class I MHC molecules display...Ch. 20 - 16. Which of the following is not a role of TH...Ch. 20 - 17. Mark the following statements as true or...Ch. 20 - 18. Type I hypersensitivity is due to release of...Ch. 20 - Prob. 19CYRCh. 20 - Prob. 20CYRCh. 20 - Prob. 1CYUCh. 20 - Complement proteins are crucial for stimulating...Ch. 20 - 3. Terrence has severe asthma and allergies, and...Ch. 20 - Your friend tests her snake-wrangling skills on an...Ch. 20 - 2. Carla presents to her physician with a...Ch. 20 - 3. Mr. White has been diagnosed with febrile...Ch. 20 - Mr. White developed neutropenia as a consequence...Ch. 20 - 5. The chemotherapeutic drugs Mr. White is taking...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Don't copy the other answerarrow_forward4. Aerobic respiration of 5 mM acetate solution. Assume no other carbon source and that acetate is equivalent to acetyl-CoA. NADH FADH2 OP ATP SLP ATP Total ATP Show your work using dimensional analysis here: 5. Aerobic respiration of 2 mM alpha-ketoglutaric acid solution. Assume no other carbon source. NADH FADH2 OP ATP Show your work using dimensional analysis here: SLP ATP Total ATParrow_forwardBiology You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?arrow_forward
- Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.arrow_forwardAwnser these Discussion Questions Answer these discussion questions and submit them as part of your lab report. Part A: The Effect of Temperature on Enzyme Activity Graph the volume of oxygen produced against the temperature of the solution. How is the oxygen production in 30 seconds related to the rate of the reaction? At what temperature is the rate of reaction the highest? Lowest? Explain. Why might the enzyme activity decrease at very high temperatures? Why might a high fever be dangerous to humans? What is the optimal temperature for enzymes in the human body? Part B: The Effect of pH on Enzyme Activity Graph the volume of oxygen produced against the pH of the solution. At what pH is the rate of reaction the highest? Lowest? Explain. Why does changing the pH affect the enzyme activity? Research the enzyme catalase. What is its function in the human body? What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…arrow_forwardAnwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forward
- How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forward
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
- Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
7 Freudian Defence Mechanisms Explained; Author: Lewis Psychology;https://www.youtube.com/watch?v=fTnjJ105ze4;License: Standard youtube license