The sulfonamides belong to the class of antibacterial compounds that act by inhibiting metabolic pathways of bacterial cells. The growth of many Gram-positive and Gram-negative bacteria are inhibited by the sulfonamides. The sulfonamides along with related compounds are known as the sulfa drugs.

Question

Want to see the full answer?

Answer 1

Question

Chapter 20, Problem 6MC

Summary Introduction

Introduction:

The sulfonamides belong to the class of antibacterial compounds that act by inhibiting metabolic pathways of bacterial cells. The growth of many Gram-positive and Gram-negative bacteria are inhibited by the sulfonamides. The sulfonamides along with related compounds are known as the sulfa drugs.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?

Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?

The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?

Answer 2

Question

Chapter 20, Problem 6MC

Summary Introduction

Introduction:

The sulfonamides belong to the class of antibacterial compounds that act by inhibiting metabolic pathways of bacterial cells. The growth of many Gram-positive and Gram-negative bacteria are inhibited by the sulfonamides. The sulfonamides along with related compounds are known as the sulfa drugs.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 3

Question

Chapter 20, Problem 6MC

Summary Introduction

Introduction:

The sulfonamides belong to the class of antibacterial compounds that act by inhibiting metabolic pathways of bacterial cells. The growth of many Gram-positive and Gram-negative bacteria are inhibited by the sulfonamides. The sulfonamides along with related compounds are known as the sulfa drugs.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 4

Question

Chapter 20, Problem 6MC

Summary Introduction

Introduction:

The sulfonamides belong to the class of antibacterial compounds that act by inhibiting metabolic pathways of bacterial cells. The growth of many Gram-positive and Gram-negative bacteria are inhibited by the sulfonamides. The sulfonamides along with related compounds are known as the sulfa drugs.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 5

Chapter 20, Problem 6MC

Summary Introduction

Introduction:

The sulfonamides belong to the class of antibacterial compounds that act by inhibiting metabolic pathways of bacterial cells. The growth of many Gram-positive and Gram-negative bacteria are inhibited by the sulfonamides. The sulfonamides along with related compounds are known as the sulfa drugs.

Answer 6

Chapter 20, Problem 6MC

Summary Introduction

Introduction:

The sulfonamides belong to the class of antibacterial compounds that act by inhibiting metabolic pathways of bacterial cells. The growth of many Gram-positive and Gram-negative bacteria are inhibited by the sulfonamides. The sulfonamides along with related compounds are known as the sulfa drugs.

Answer 7

Chapter 20, Problem 6MC

Summary Introduction

Introduction:

The sulfonamides belong to the class of antibacterial compounds that act by inhibiting metabolic pathways of bacterial cells. The growth of many Gram-positive and Gram-negative bacteria are inhibited by the sulfonamides. The sulfonamides along with related compounds are known as the sulfa drugs.

Answer 8

Expert Solution & Answer

Answer 9

Expert Solution & Answer

Answer 10

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 11

Ch. 20 - Describe the difference between the terms...Ch. 20 - 2. Define therapeutic index and explain its...Ch. 20 - 3. Explain how penicillin-binding proteins (PBPs)...Ch. 20 - Name three classes of antimicrobial medications...Ch. 20 - Explain the roles of the first-line drugs versus...Ch. 20 - 6. Compare and contrast the method for...Ch. 20 - Name three targets that can be altered...Ch. 20 - What is MRSA? Why is it significant?Ch. 20 - Prob. 9SA Ch. 20 - 10. Explain the difference between the mechanism...

The sulfonamides belong to the class of antibacterial compounds that act by inhibiting metabolic pathways of bacterial cells. The growth of many Gram-positive and Gram-negative bacteria are inhibited by the sulfonamides. The sulfonamides along with related compounds are known as the sulfa drugs.

Solution Summary: The author explains that sulfonamides inhibit the growth of many Gram-positive and Gram negative bacteria by inhibiting the pathway of folate synthesis.

Videos

Want to see the full answer?

Chapter 20 Solutions