The reason behind taking a board spectrum antibiotic agents. Introduction: The word broad-spectrum antibiotic refers to the antibiotics which work on the two prime bacterial clubs, namely, gram-positive and gram-negative. These antibiotics are mainly used when the bacterial infection is present, however, the group of bacteria causing the infection is unknown.

Question

Want to see the full answer?

Answer 1

Question

Chapter 20, Problem 3CT

Summary Introduction

To review:

The reason behind taking a board spectrum antibiotic agents.

Introduction:

The word broad-spectrum antibiotic refers to the antibiotics which work on the two prime bacterial clubs, namely, gram-positive and gram-negative. These antibiotics are mainly used when the bacterial infection is present, however, the group of bacteria causing the infection is unknown.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

What would happen if transcriptome analysis were done on liver and muscle cells?

Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?

Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?

Answer 2

Question

Chapter 20, Problem 3CT

Summary Introduction

To review:

The reason behind taking a board spectrum antibiotic agents.

Introduction:

The word broad-spectrum antibiotic refers to the antibiotics which work on the two prime bacterial clubs, namely, gram-positive and gram-negative. These antibiotics are mainly used when the bacterial infection is present, however, the group of bacteria causing the infection is unknown.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 3

Question

Chapter 20, Problem 3CT

Summary Introduction

To review:

The reason behind taking a board spectrum antibiotic agents.

Introduction:

The word broad-spectrum antibiotic refers to the antibiotics which work on the two prime bacterial clubs, namely, gram-positive and gram-negative. These antibiotics are mainly used when the bacterial infection is present, however, the group of bacteria causing the infection is unknown.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 4

Question

Chapter 20, Problem 3CT

Summary Introduction

To review:

The reason behind taking a board spectrum antibiotic agents.

Introduction:

The word broad-spectrum antibiotic refers to the antibiotics which work on the two prime bacterial clubs, namely, gram-positive and gram-negative. These antibiotics are mainly used when the bacterial infection is present, however, the group of bacteria causing the infection is unknown.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 5

Chapter 20, Problem 3CT

Summary Introduction

To review:

The reason behind taking a board spectrum antibiotic agents.

Introduction:

The word broad-spectrum antibiotic refers to the antibiotics which work on the two prime bacterial clubs, namely, gram-positive and gram-negative. These antibiotics are mainly used when the bacterial infection is present, however, the group of bacteria causing the infection is unknown.

Answer 6

Chapter 20, Problem 3CT

Summary Introduction

To review:

The reason behind taking a board spectrum antibiotic agents.

Introduction:

The word broad-spectrum antibiotic refers to the antibiotics which work on the two prime bacterial clubs, namely, gram-positive and gram-negative. These antibiotics are mainly used when the bacterial infection is present, however, the group of bacteria causing the infection is unknown.

Answer 7

Chapter 20, Problem 3CT

Summary Introduction

To review:

The reason behind taking a board spectrum antibiotic agents.

Introduction:

The word broad-spectrum antibiotic refers to the antibiotics which work on the two prime bacterial clubs, namely, gram-positive and gram-negative. These antibiotics are mainly used when the bacterial infection is present, however, the group of bacteria causing the infection is unknown.

Answer 8

Expert Solution & Answer

Answer 9

Expert Solution & Answer

Answer 10

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 11

Ch. 20 - The five figures to the right are labeled a...Ch. 20 - Prob. 2RFT Ch. 20 - Prob. 3RFT Ch. 20 - The most abundant proteins in blood are (a)...Ch. 20 - 5. The major classes of white blood cells...Ch. 20 - Prob. 6RFT Ch. 20 - Prob. 7RFT Ch. 20 - Prob. 8RFT Ch. 20 - Prob. 9RFT Ch. 20 - Prob. 10RFT

Solution Summary: The author explains that broad-spectrum antibiotics are used to kill a large number of bacteria that are both pathogenic and non-pathogenic.

Concept explainers

Want to see the full answer?

Chapter 20 Solutions