
For each of the terms in the left column, choose the best matching phrase in the right column.
a. | mitogenic growth | 1. | mutations in these genes are factor dominant for cancer formation |
b. | tumor-suppressor | 2. | programmed cell death genes |
c. | cyclin-dependent | 3. | series of steps by which a message is protein kinases transmitted |
d. | apoptosis | 4. | proteins that are active cyclically during the cell cycle |
e. | oncogenes | 5. | control progress in the cell cycle in response to DNA damage |
f. | growth factor | 6. | mutations in these genes are recessive receptor at the cellular level for cancer formation |
g. | signal transduction | 7. | signals a cell to leave G0 and enter G1 |
h. | checkpoints | 8. | cell-cycle enzymes that phosphorylate proteins |
i. | cyclins | 9. | protein that binds a hormone |

a.
To determine:
The phrase that describes “mitogenic growth” among the options given below.
1. | mutations in these genes are factor dominant for cancer formation |
2. | programmed cell death genes |
3. | series of steps by which a message is protein kinases transmitted |
4. | proteins that are active cyclically during the cell cycle |
5. | control progress in the cell cycle in response to DNA damage |
6. | mutations in these genes are recessive receptor at the cellular level for cancer formation |
7. | signals a cell to leave G0 and enter G1 |
8. | cell-cycle enzymes that phosphorylate proteins |
9. | protein that binds a hormone |
Introduction:
Some factors associated with the mitogenic growth helps in the regulation of cell cycle.
Answer to Problem 1P
Correct answer:
Mitogenic growth: Signals a cell to leave G0 and enter G1
Explanation of Solution
The mitogenic growth factors regulate the cell cycle. These factors gives signals to cell to leave G0 and enter G1 phase of cell cycle.

b.
To determine:
The phrase that describes “tumor suppressor” among the options given below.
1. | mutations in these genes are factor dominant for cancer formation |
2. | programmed cell death genes |
3. | series of steps by which a message is protein kinases transmitted |
4. | proteins that are active cyclically during the cell cycle |
5. | control progress in the cell cycle in response to DNA damage |
6. | mutations in these genes are recessive receptor at the cellular level for cancer formation |
7. | signals a cell to leave G0 and enter G1 |
8. | cell-cycle enzymes that phosphorylate proteins |
9. | protein that binds a hormone |
Introduction:
The process of proliferation of cells are blocked by the tumor suppressor genes.
Answer to Problem 1P
Correct answer:
Tumor suppressure: Mutations in these genes are recessive receptor at the cellular level for cancer formation
Explanation of Solution
The tumor-suppressor genes are the genes which restrict the cell proliferation. The mutations in the tumor-suppressor genes are recessive at the cellular level and can cause cancer.

c.
To determine:
The phrase that describes “cyclin dependent” among the options given below.
1. | mutations in these genes are factor dominant for cancer formation |
2. | programmed cell death genes |
3. | series of steps by which a message is protein kinases transmitted |
4. | proteins that are active cyclically during the cell cycle |
5. | control progress in the cell cycle in response to DNA damage |
6. | mutations in these genes are recessive receptor at the cellular level for cancer formation |
7. | signals a cell to leave G0 and enter G1 |
8. | cell-cycle enzymes that phosphorylate proteins |
9. | protein that binds a hormone |
Introduction:
Cyclin dependent enzymes are those that helps in the phophorylation of the proteins.
Answer to Problem 1P
Correct answer:
Cyclin-dependent: Cell-cycle enzymes that phosphorylate proteins
Explanation of Solution
The cyclin dependent protein kinases regulate the cell cycle through phosphorylation of other proteins. The phoshphorylation of the other proteins happens through signal transduction cascade mechanism.

d.
To determine:
The phrase that describes “apoptosis” among the options given below.
1. | mutations in these genes are factor dominant for cancer formation |
2. | programmed cell death genes |
3. | series of steps by which a message is protein kinases transmitted |
4. | proteins that are active cyclically during the cell cycle |
5. | control progress in the cell cycle in response to DNA damage |
6. | mutations in these genes are recessive receptor at the cellular level for cancer formation |
7. | signals a cell to leave G0 and enter G1 |
8. | cell-cycle enzymes that phosphorylate proteins |
9. | protein that binds a hormone |
Introduction:
The phenomenone of specific programmed cell death is referred to as apoptosis.
Answer to Problem 1P
Correct answer:
Apoptosis: Programmed cell death genes
Explanation of Solution
Apoptosis is also called programmed cell death. It sustain the balance of cells in the human body which is important for the immune system.

e.
To determine:
The phrase that describes “oncogenes” among the options given below.
1. | mutations in these genes are factor dominant for cancer formation |
2. | programmed cell death genes |
3. | series of steps by which a message is protein kinases transmitted |
4. | proteins that are active cyclically during the cell cycle |
5. | control progress in the cell cycle in response to DNA damage |
6. | mutations in these genes are recessive receptor at the cellular level for cancer formation |
7. | signals a cell to leave G0 and enter G1 |
8. | cell-cycle enzymes that phosphorylate proteins |
9. | protein that binds a hormone |
Introduction:
Mutation process in the oncogenes results in the cancer.
Answer to Problem 1P
Correct answer:
Oncogenes: Mutations in these genes are factor dominant for cancer formation
Explanation of Solution
The oncogenes occur as protooncogenes at a cellular level. The protooncogenes carry normal function of cell proliferation. The mutations in the oncogenes causes cancer. It results in unlimited growth of cells.

f.
To determine:
The phrase that describes “growth factors” among the options given below.
1. | mutations in these genes are factor dominant for cancer formation |
2. | programmed cell death genes |
3. | series of steps by which a message is protein kinases transmitted |
4. | proteins that are active cyclically during the cell cycle |
5. | control progress in the cell cycle in response to DNA damage |
6. | mutations in these genes are recessive receptor at the cellular level for cancer formation |
7. | signals a cell to leave G0 and enter G1 |
8. | cell-cycle enzymes that phosphorylate proteins |
9. | protein that binds a hormone |
Introduction:
Some receptor that are most oftenly present on the surface of cells and are associated with the growth are referrd to as growth factors.
Answer to Problem 1P
Correct answer:
Growth factor: Protein that binds a hormone
Explanation of Solution
Growth factor receptors are present on the cell surface. The growth factor binds with these receptors to trigger the signal transduction cascade.

g.
To determine:
The phrase that describes “signal transduction” among the options given below.
1. | mutations in these genes are factor dominant for cancer formation |
2. | programmed cell death genes |
3. | series of steps by which a message is protein kinases transmitted |
4. | proteins that are active cyclically during the cell cycle |
5. | control progress in the cell cycle in response to DNA damage |
6. | mutations in these genes are recessive receptor at the cellular level for cancer formation |
7. | signals a cell to leave G0 and enter G1 |
8. | cell-cycle enzymes that phosphorylate proteins |
9. | protein that binds a hormone |
Introduction:
Series of steps or sequence of reactions is called signal transduction.
Answer to Problem 1P
Correct answer:
Signal transduction: Series of steps by which a message is protein kinases transmitted
Explanation of Solution
Signal transduction is a sequence of reactions through which a message is transmitted. The reactions are stimulated by the interaction between the cell and its surface receptor.

h.
To determine:
The phrase that describes “checkpoints” among the options given below.
1. | mutations in these genes are factor dominant for cancer formation |
2. | programmed cell death genes |
3. | series of steps by which a message is protein kinases transmitted |
4. | proteins that are active cyclically during the cell cycle |
5. | control progress in the cell cycle in response to DNA damage |
6. | mutations in these genes are recessive receptor at the cellular level for cancer formation |
7. | signals a cell to leave G0 and enter G1 |
8. | cell-cycle enzymes that phosphorylate proteins |
9. | protein that binds a hormone |
Introduction:
Check points are referred to as the check points and are present througout the cell cycle.
Answer to Problem 1P
Correct answer:
Checkpoints: Control progress in the cell cycle in response to DNA damage
Explanation of Solution
The cell has a repair mechanism to correct the DNA damage. These control points are called as check points. Different checkpoints are present throughout the cycle so that mutated DNA is not divided or replicated.

i.
To determine:
The phrase that describes “cyclins” among the options given below.
1. | mutations in these genes are factor dominant for cancer formation |
2. | programmed cell death genes |
3. | series of steps by which a message is protein kinases transmitted |
4. | proteins that are active cyclically during the cell cycle |
5. | control progress in the cell cycle in response to DNA damage |
6. | mutations in these genes are recessive receptor at the cellular level for cancer formation |
7. | signals a cell to leave G0 and enter G1 |
8. | cell-cycle enzymes that phosphorylate proteins |
9. | protein that binds a hormone |
Introduction:
Some proteins are used for the regulation or control of transition of cell cycle ans are called cyclins.
Answer to Problem 1P
Correct answer:
Cyclins: Proteins that are active cyclically during the cell cycle
Explanation of Solution
The cyclin dependant kinases are the protein kinases which control the transition of the cell cycle. The cyclin protein is responsible for the function of cyclin dependent kinases.
Want to see more full solutions like this?
Chapter 20 Solutions
Genetics: From Genes to Genomes
- Don't copy the other answerarrow_forward4. Aerobic respiration of 5 mM acetate solution. Assume no other carbon source and that acetate is equivalent to acetyl-CoA. NADH FADH2 OP ATP SLP ATP Total ATP Show your work using dimensional analysis here: 5. Aerobic respiration of 2 mM alpha-ketoglutaric acid solution. Assume no other carbon source. NADH FADH2 OP ATP Show your work using dimensional analysis here: SLP ATP Total ATParrow_forwardBiology You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?arrow_forward
- Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.arrow_forwardAwnser these Discussion Questions Answer these discussion questions and submit them as part of your lab report. Part A: The Effect of Temperature on Enzyme Activity Graph the volume of oxygen produced against the temperature of the solution. How is the oxygen production in 30 seconds related to the rate of the reaction? At what temperature is the rate of reaction the highest? Lowest? Explain. Why might the enzyme activity decrease at very high temperatures? Why might a high fever be dangerous to humans? What is the optimal temperature for enzymes in the human body? Part B: The Effect of pH on Enzyme Activity Graph the volume of oxygen produced against the pH of the solution. At what pH is the rate of reaction the highest? Lowest? Explain. Why does changing the pH affect the enzyme activity? Research the enzyme catalase. What is its function in the human body? What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…arrow_forwardAnwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forward
- How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forward
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax





