
Concept explainers
A plasmid that is both ampicillin and tetracycline resistant is cleaved with Pstl, which cleaves within the ampicillin resistance gene. The cut plasmid is ligated with Pstl-digested Drosophila DNA to prepare a genomic library, and the mixture is used to transform E. coli K12.
- (a) Which antibiotic should be added to the medium to select cells that have incorporated a plasmid?
- (b) If recombinant cells were plated on medium containing ampicillin or tetracycline and medium with both antibiotics, on which plates would you expect to see growth of bacteria containing plasmids with Drosophila DNA inserts?
- (c) How can you explain the presence of colonies that are resistant to both antibiotics?
(a)

To determine: The antibiotic that an individual should add to the medium to select cells that contain the recombinant plasmid.
Introduction: Plasmid refers to an circular, extrachromosomal DNA (deoxyribonucleic acid) molecule that replicates chromosome independently.
Explanation of Solution
The gene that confers resistance to tetracycline is intact in the recombinant plasmid. An individual would add tetracycline to the medium to select the recombinant plasmd in the cells. In the medium, the bacteria that have been transformed with recombinant plasmid will be resistant to tetracycline.
Thus, an individual would use tetracycline to select cells that contain the recombinant plasmid.
(b)

To determine: The plates on which an individual might see the growth of bacteria having plasmids with Drosophila DNA inserts.
Introduction: Genetically modified bacterial plasmids were the first developed vectors, used for cloning purpose.
Explanation of Solution
Cloning is a important process in which bacterial cells containing recombinant DNA can be readily identified. This process is also accomplished is through the use of selectable marker genes. Antibiotic resistant genes provide very effective selectable marker genes. Therefore, the colonies that grow on tetracycline medium but do not grow on ampicillin medium would contain the Drosophila DNA insert.
Thus, colonies that only grow in tetracycline medium probably contain the Drosophila DNA insert.
(c)

To determine: The reason that some colonies can grow on tetracycline medium as well as ampicillin medium.
Introduction: Plasmids have an origin of replication (ori) site, which makes it possible to produce several hundred copies of a plasmid in a single host cell.
Explanation of Solution
When performing cloning process, it is not necessary for incorporation of all DNA plasmids need to be cloned. A plasmid cut with a restriction enzyme generating sticky ends can self-ligate if cut ends of the plasmid rejoin. Also, if cleavage with PstI was incomplete, then no change in biological characteristics of the uncut plasmid would be expected.
Thus, self-ligation of plasmid and incomplete cleavage with PstI are responsible for the growth of colonies that are resistant to both antibiotics.
Want to see more full solutions like this?
Chapter 20 Solutions
Concepts of Genetics (12th Edition)
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningCase Studies In Health Information ManagementBiologyISBN:9781337676908Author:SCHNERINGPublisher:Cengage




