
Concept explainers
To determine:
The reason as to why antibiotics can be purchased without a prescription in some developing countries.
Introduction:
Antibiotics are the drugs that inhibit the growth of bacteria by interfering with their natural mechanism of the central dogma. The process of replication, transcription, and translation are altogether referred as the central dogma of life. Antibiotic drugs interfere with these processes of bacteria and inhibit their growth.

Explanation of Solution
In some developing countries, people take antibiotics and other medicines without a prescription. It is because people avoid visiting doctors in order to save money as they believe doctors are going to prescribe the same medication. People take antibiotics as they believe antibiotics are the root treatment for any kind of disease, but it is not true. Antibiotics only work against bacterial diseases.
To determine:
Biological consequences that could result if people continue to purchase antibiotics without a prescription.
Introduction:
Antibiotic resistance is a phenomenon which could result in making a microbe resistant to the effects of a certain medication. Antibiotic resistance can lead to untreatable pathogens.

Explanation of Solution
Excess intake of these antibiotics would cause the bacteria to develop tolerance against it and become resistant to it. Many of the bacterial strains that were not resistant to it would die and some would survive by
Medicines should be taken only after prescription of a doctor. Otherwise, worse consequences would be seen.
Want to see more full solutions like this?
Chapter 20 Solutions
Biology: Life on Earth with Physiology Plus Mastering Biology with Pearson eText -- Access Card Package (11th Edition)
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Comprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage Learning
- Lifetime Physical Fitness & WellnessHealth & NutritionISBN:9781337677509Author:HOEGERPublisher:CengageBasic Clinical Lab Competencies for Respiratory C...NursingISBN:9781285244662Author:WhitePublisher:Cengage
