NESTER'S MICROBIOLOGY
9th Edition
ISBN: 9781264826940
Author: Anderson
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Question
Chapter 20, Problem 1A
Summary Introduction
To review:
The rationale behind the prescription of a lower dose of the antibiotic for the elderly woman compared to the young one, inspite of their similarities in the weight, other body dimensions, and the disease.
Introduction:
One elderly woman and a young woman are suffering from urinary tract infections (UTI) caused by similar bacteria. Their physician still prescribed a small dosage of the antibiotic to the elderly woman compared to the young woman, though they share the same body dimensions and weight. UTI affect the urethra, ureters, bladder, and the kidneys.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 20 Solutions
NESTER'S MICROBIOLOGY
Ch. 20 - Describe the difference between the terms...Ch. 20 -
2. Define therapeutic index and explain its...Ch. 20 -
3. Explain how penicillin-binding proteins (PBPs)...Ch. 20 - Name three classes of antimicrobial medications...Ch. 20 - Explain the roles of the first-line drugs versus...Ch. 20 -
6. Compare and contrast the method for...Ch. 20 - Name three targets that can be altered...Ch. 20 - What is MRSA? Why is it significant?Ch. 20 - Prob. 9SACh. 20 -
10. Explain the difference between the mechanism...
Ch. 20 - Which of the following targets would you expect to...Ch. 20 -
2. Penicillin has been modified to make...Ch. 20 -
3. Which of the following is the target of...Ch. 20 -
4. Which of the following statements is false?
a)...Ch. 20 - Prob. 5MCCh. 20 - Prob. 6MCCh. 20 - Prob. 7MCCh. 20 - Prob. 8MCCh. 20 - Prob. 9MCCh. 20 - Prob. 10MCCh. 20 - Prob. 1ACh. 20 - Prob. 2ACh. 20 - Prob. 1CTCh. 20 - Prob. 2CT
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning
- Principles Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning

Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning
Bacterial Infections in Humans; Author: Professor Dave Explains;https://www.youtube.com/watch?v=FeFKAl9KyMg;License: Standard Youtube License