
Concept explainers
To identify: The major brain regions in Fig 20.1.
Introduction: The brain is the most vital organ in the human body. The brain has three major regions namely, the cerebrum, brainstem, and cerebellum. The brain is the central processing unit of the body as most of the processes such as, voluntary to involuntary function and the cognitive function, are carried out by the brain.

Answer to Problem 1.1BGL
Pictorial representation:
Fig.1: The major brain regions.
Explanation of Solution
Cerebrum: The cerebrum is the biggest and the most complicated among all the regions and structures of the brain. The cerebrum is divided into the left and right hemispheres. The cerebrum account for higher mental functions, cognitive thinking, and intelligence. The cerebrum accounts for thinking and reasoning to process the information from the surrounding that can implement the desired movement in the skilled skeletal movement.
Cerebellum: The cerebellum is also called as little brain and located inferior to the cerebrum and posterior to the pons and medulla oblongata. The vital functions of the cerebellum are to process sensory information, maintain balance, posture, and aid in the movement of the skeletal muscles in a skillful way. Depending upon the injury in the cerebellum, the person can be paraplegic from the neck to the feet, paraplegic only to the waist, or only below the waist. Some minor injury in the cerebellum can lead to the unsteady gait, loss of coordinated movement, and slurred speech.
Diencephalon: The “di” means two and “encephalon” means the brain, as it is embedded inferior to the two cerebral hemispheres and anterior to the midbrain. Thus, the diencephalon occupies the central region of the brain. The diencephalon contains the thalamus, hypothalamus, and epithalamus, which are important for secreting hormones, process sleep wake cycle, express emotions, and process sensation to eat and drink.
Brain stem: The brain stem has three major regions namely, the pons, midbrain, and medulla oblongata. The brain stem is located posterior to the superior brain region. The brain stem is a vital feature of the brain as it maintains consciousness as well as regulate the sleep cycle. Any injury to the brain stem leads to life-threatening complications.
Want to see more full solutions like this?
Chapter 20 Solutions
Laboratory Manual for Anatomy and Physiology, 6e Loose-Leaf Print Companion with WileyPLUS Blackboard Card Set
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





