EBK HUMAN ANATOMY & PHYSIOLOGY
1st Edition
ISBN: 9780100659834
Author: AMERMAN
Publisher: YUZU
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 2, Problem 6CYR
What are hydrogen bonds, and how do they form?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 2 Solutions
EBK HUMAN ANATOMY & PHYSIOLOGY
Ch. 2.1 - Prob. 1QCCh. 2.1 - What are atoms?Ch. 2.1 - How do the three types of subatomic particles...Ch. 2.1 - What is an element?Ch. 2.1 - 4. How are elements arranged in the periodic...Ch. 2.1 - What are isotopes?Ch. 2.1 - Prob. 1AWYLCh. 2.1 - The element lithium has an atomic number of 3 and...Ch. 2.2 - What is a mixture?Ch. 2.2 - 2. How do the three types of mixtures differ?
Ch. 2.2 - Prob. 3QCCh. 2.2 - What is an ionic bond?Ch. 2.2 - 5. How is an ionic bond formed?
Ch. 2.2 - 6. Explain how polar and nonpolar covalent bonds...Ch. 2.2 - What are hydrogen bonds? Why do hydrogen bonds...Ch. 2.2 - Which would be more reactive-an atom of fluorine...Ch. 2.2 - Would a molecule of hydrogen (H2) form hydrogen...Ch. 2.2 - Explain why the molecule Na2 does not exist in...Ch. 2.3 - Prob. 1QCCh. 2.3 - Prob. 2QCCh. 2.3 - How do endergonic and exergonic reactions differ?Ch. 2.3 - Prob. 4QCCh. 2.3 - What factors can influence the rate of a chemical...Ch. 2.3 - 6. What is an enzyme, and what does an enzyme do?
Ch. 2.3 - Prob. 1AWYLCh. 2.3 - Explain why most biological molecules are stable...Ch. 2.3 - 3. Many naturally occurring poisons function by...Ch. 2.4 - What are four properties of water that make it a...Ch. 2.4 - 2. Which molecules are likely to be hydrophilic?...Ch. 2.4 - 3. Define the terms acid and base.
Ch. 2.4 - What is the pH scale? Which pH values are...Ch. 2.4 - What is the effect of a buffer on a solution?Ch. 2.4 - What is a salt?Ch. 2.4 - 7. What does an electrolyte do in a solution?
Ch. 2.4 - Explain how the water surrounding a fetus in the...Ch. 2.4 - Prob. 2AWYLCh. 2.5 - 1. How do polymers and monomers differ?
Ch. 2.5 - 2.3. How do monosaccharides, disaccharides, and...Ch. 2.5 - 2. How do monosaccharides, disaccharides, and...Ch. 2.5 - How are two monosaccharides linked to form a...Ch. 2.5 - Prob. 5QCCh. 2.5 - 5. How do phospholipids and triglycerides differ?
Ch. 2.5 - What are steroids?Ch. 2.5 - Prob. 8QCCh. 2.5 - How are amino acids linked to form peptides and...Ch. 2.5 - What are the four levels of structural...Ch. 2.5 - 10. What are the components and roles of ATP?
Ch. 2.5 - 11. How do DNA and RNA differ?
Ch. 2.5 - 11. What are the three components of a...Ch. 2.5 - Which molecule would be the most soluble in water:...Ch. 2.5 - In Module 2.3, you learned that increasing...Ch. 2.5 - 3. How could a defect in a gene lead to a...Ch. 2 - Prob. 1CYRCh. 2 - Fill in the blanks: Isotopes are atoms with the...Ch. 2 - 3. Which of the following statements correctly...Ch. 2 - 4. Explain the difference between an ionic and a...Ch. 2 - Identify each of the following molecules or...Ch. 2 - What are hydrogen bonds, and how do they form?Ch. 2 - Prob. 7CYRCh. 2 - Prob. 8CYRCh. 2 - Which of the following would not result in an...Ch. 2 - 10. An enzyme is a:
a. biological catalyst that...Ch. 2 - Prob. 11CYRCh. 2 - With respect to their solubility in water,...Ch. 2 - Mark the following statements as true or false. If...Ch. 2 - A salt is: a. a metal cation bonded to a nonmetal...Ch. 2 - 15. Compare and contrast the structures of...Ch. 2 - 16. Mark the following statements as true or...Ch. 2 - 17. Why is it important for a protein to maintain...Ch. 2 - Which of the following is not part of a...Ch. 2 - 19. Mark the following properties as belonging to...Ch. 2 - Which of the following statements is/are true...Ch. 2 - 1. In certain types of radioactive decay, the...Ch. 2 - Considering that water is a main component of the...Ch. 2 - 3. Explain why monosaccharides are polar and fatty...Ch. 2 - 1. The polysaccharide cellulose is not digestible...Ch. 2 - Some claim that the pH of your blood can be...Ch. 2 - Prob. 3AYKCh. 2 - Prob. 5AYKCh. 2 - You have just dropped some phospholipids into...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Principles Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Macromolecules | Classes and Functions; Author: 2 Minute Classroom;https://www.youtube.com/watch?v=V5hhrDFo8Vk;License: Standard youtube license