
a.
To explain:
The use of lactophenol cotton blue dye, to stain the cytoplasm of a protozoan Amoeba proteus, enhances which property of the microscope.
Introduction:
The staining or dying of the specimen is performed to clearly visualize and distinguish the parts of the cells under microscope. The stain highlights the structures of the cell. Staining of the specimen supports the examination of different types of organelles and different types of tissues. The dyes are specific to cellular structure, so different types of dyes are used for the identification of different organelles of the cell.
b.
To determine:
The type of microscope used to visualize a viral pathogen present in the biopsy of the patient’s lung.
Introduction:
Microscopy is the study of a specimen with the help of a microscope. The microscope helps to identify and study the external and internal structures of a specimen. A microscope also confirms the presence of microbes in the given sample.
To determine:
The type of microscope to visualize the presence of multiple organisms within a specimen.
Introduction:
Different types of the organisms vary in their shape and size. The presence or absence of appendages also differentiates the types of microorganisms. The microscopes are used to identify and confirm the presence of the microorganisms in the given sample.
To determine:
The type of microscope to visualize the organelles within a eukaryotic cell.
Introduction:
Plant cells and animal cells are called as the eukaryotic cells. The eukaryotic cells possess the characteristic “true nucleus”. Various cellular organelles are also the part of eukaryotic cells. The organelles of eukaryotic cells are membrane-bound and perform a particular function.

Want to see the full answer?
Check out a sample textbook solution
Chapter 2 Solutions
EBK MICROBIOLOGY FUNDAMENTALS: A CLINIC
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





