
With the initial appearance of the feature we call “Now Solve This,” a short introduction is in order. The feature occurs several times in this and all ensuing chapters, each time providing a problem related to the discussion just presented. A “Hint” is then offered that may help you solve the problem. Here is the first problem:
- (a) If an organism has a diploid number of 16, how many chromatids are visible at the end of mitotic prophase?
- (b) How many chromosomes are moving to each pole during anaphase of mitosis?
(a)

To determine: The number of chromatids that are visible at the end of prophase stage of mitosis.
Introduction: Mitosis is a process of division in which two daughter cells produce, and each daughter cell has the same complement of chromosomes as the parent cell.
Explanation of Solution
Prophase is the first stage of mitosis. In this stage, chromatin fibers start to condense, and nuclear envelope disappears, and centrioles divide. As chromatin fibers condense, the thread-like structures, the chromosomes, become visible.
It becomes apparent near the end of prophase that each chromosome consists of two parts, which are called sister chromatids. For example, if an organism has diploid number of 16 chromosomes, 32 chromatids would be visible at the end of mitotic prophase.
(b)

To determine: The number of chromosomes that move towards the opposite poles during anaphase.
Introduction: Mitosis is divided into several stages: prophase, prometaphase, metaphase, anaphase, and telophase.
Explanation of Solution
In metaphase, the homologous chromosomes duplicate. Anaphase is the shortest stage of mitosis. The events critical to chromosome distribution occur during this stage. In this stage, sister chromatids of each chromosome disjoin from one other and are pulled towards opposite ends. This event is described as disjunction. If an organism has a diploid number of 16 chromosomes, 16 chromosomes will move towards the opposite poles during anaphase.
Want to see more full solutions like this?
Chapter 2 Solutions
Concepts of Genetics (11th Edition)
Additional Science Textbook Solutions
Microbiology: An Introduction
Organic Chemistry (8th Edition)
Chemistry: An Introduction to General, Organic, and Biological Chemistry (13th Edition)
Physics for Scientists and Engineers: A Strategic Approach, Vol. 1 (Chs 1-21) (4th Edition)
Campbell Biology (11th Edition)
Applications and Investigations in Earth Science (9th Edition)
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningAnatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College





