
Concept explainers
Why did Mendel’s work refute the idea of blending inheritance?

To review:
The reason as to why Mendel refuted the idea of blending inheritance.
Introduction:
Mendel worked on pea plants and conducted various crosses (Monohybrid and Dihybrid) and concluded several results such as the law of dominance, the law of segregation and the law of independent assortment. Darwin’s Pangenesis was also based on this concept but Mendel, on the basis of his monohybrid cross hypothesis, proved that the offspring are of parental character and do not differ from generation-to-generation.
Explanation of Solution
The theory of blending inheritance is a superseded theory which states that when a character is passed on from parents to offspring, it produces an intermediate character in the offspring. However, Mendel refuted this theory by conducting his monohybrid crosson a pea plant’sheight. The offsprings produced were either tall or short, while no intermediate character was seen or reported.
After conducting his experiment Mendel observed that in the F1 (first filial) generation, all the plants were tall. More convincing results were observed in the F2 (second filial) generation. Three-fourth (3/4) of the plants were tall and one-fourth (1/4) were dwarf, that is, both the F1 and F2 generations showed that plants were similar to their parental generation.
Therefore, it can be concluded that when a character is inherited by the offspring from the parents, it produces its full character and no intermediate effect is seen. Thus, Mendel’s work refuted the idea of blending inheritance.
Want to see more full solutions like this?
Chapter 2 Solutions
Genetics: Analysis and Principles
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning





