
Foundations in Microbiology
10th Edition
ISBN: 9781259705212
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Question
Chapter 19.L1, Problem 10WC
Summary Introduction
To determine:
- The characteristics that make M. leprae different from other mycobacteria.
- The difference between tuberculoid and lepromatous leprosy
Introduction:
Mycobacterium leprae is the causative organism of leprosy. It causes granulomatous skin infection and sensory loss that leads to disfigurement and deformation of parts of the body.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 19 Solutions
Foundations in Microbiology
Ch. 19.1 - 1. Describe how cellular characteristics are used...Ch. 19.1 - 1. Explain why Bacillus, Clostridium, and...Ch. 19.2 - 2. Recall the general characteristics of the genus...Ch. 19.2 - 3. Distinguish between cutaneous and pulmonary...Ch. 19.2 - 4. State the general characteristics of the genus...Ch. 19.2 - 5. Recall the organisms responsible for...Ch. 19.2 - Prob. 6ELOCh. 19.2 - Prob. 7ELOCh. 19.2 - Prob. 8ELOCh. 19.2 - 9. Compare food intoxication caused by Bacillus...
Ch. 19.2 - Prob. 2CYPCh. 19.2 - Prob. 3CYPCh. 19.2 - 4. What are the common elements of puncture...Ch. 19.2 - 5. What is the relationship between the normal...Ch. 19.2 - Prob. 6CYPCh. 19.2 - Prob. 7CYPCh. 19.2 - 8. ln what way is the ingested agent responsible...Ch. 19.3 - 10. Relate the severity of listeriosis with the...Ch. 19.3 - 11. Explain why people in certain occupations are...Ch. 19.3 - 9. Compare the effects of listeriosis in healthy...Ch. 19.3 - 10. Why do erysipeloids commonly appear on the...Ch. 19.4 - Prob. 12ELOCh. 19.4 - Prob. 13ELOCh. 19.4 - Prob. 11CYPCh. 19.4 - Prob. 12CYPCh. 19.5 - Prob. 14ELOCh. 19.5 - Prob. 15ELOCh. 19.5 - Prob. 16ELOCh. 19.5 - Prob. 17ELOCh. 19.5 - 18. Explain the significance of nontuberculous...Ch. 19.5 - Prob. 13CYPCh. 19.5 - 14. Compile a list of the advantages,...Ch. 19.5 - 15. Explain how and why antibacterial treatment...Ch. 19.5 - 16. List several differences between lepromatous...Ch. 19.5 - Prob. 17CYPCh. 19.5 - 18. List the diseases and at-risk populations...Ch. 19.6 - Prob. 19ELOCh. 19.6 - 20. Describe the types of infections attributable...Ch. 19.6 - 19. Compare the types of infections caused by the...Ch. 19.L1 - 1. What is/are the usual habitat(s) of...Ch. 19.L1 - Prob. 2MCQCh. 19.L1 - Prob. 3MCQCh. 19.L1 - 4. Clostridium perfringens causes a. myonecrosis...Ch. 19.L1 - Prob. 5MCQCh. 19.L1 - Prob. 6MCQCh. 19.L1 - Prob. 7MCQCh. 19.L1 - Prob. 8MCQCh. 19.L1 - Prob. 9MCQCh. 19.L1 - 10. Soil mycobacteria can be the cause of a....Ch. 19.L1 - Prob. 11MCQCh. 19.L1 - Prob. 12MCQCh. 19.L1 - Prob. 13MCQCh. 19.L1 - Prob. 14MCQCh. 19.L1 - Prob. 15MCQCh. 19.L1 - 16. Matching. Match the disease with the principal...Ch. 19.L1 - Prob. 1CSRCh. 19.L1 - 2. During this outbreak, some people sickened with...Ch. 19.L1 - 3. No listeria monocytogenes was discovered in the...Ch. 19.L1 - Prob. 1WCCh. 19.L1 - Prob. 2WCCh. 19.L1 - Prob. 3WCCh. 19.L1 - Prob. 4WCCh. 19.L1 - Prob. 5WCCh. 19.L1 - 6. a. Why is listeriosis a serious problem even...Ch. 19.L1 - Prob. 7WCCh. 19.L1 - Prob. 8WCCh. 19.L1 - 9. a. Outline the unique characteristics of...Ch. 19.L1 - Prob. 10WCCh. 19.L1 - 11. a. What is the importance of NTM? b. Describe...Ch. 19.L1 - Prob. 12WCCh. 19.L2 - Prob. 1CTCh. 19.L2 - 2. a. Why is it unlikely that diseases such as...Ch. 19.L2 - Prob. 3CTCh. 19.L2 - Prob. 4CTCh. 19.L2 - Prob. 5CTCh. 19.L2 - 6. Adequate cooking is the usual way to prevent...Ch. 19.L2 - 7. a. Why do patients who survive tetanus and...Ch. 19.L2 - Prob. 8CTCh. 19.L2 - 9. How can one tell that acne involves an...Ch. 19.L2 - Prob. 10CTCh. 19.L2 - Prob. 11CTCh. 19.L2 - Prob. 12CTCh. 19.L2 - 13. Which diseases discussed in this chapter have...Ch. 19.L2 - 14. Eighty-six people at a St. Patrick's Day...Ch. 19.L2 - 15. An outbreak of gastrointestinal illness was...Ch. 19.L2 - Prob. 1VCCh. 19.L2 - 2. From chapter 3, figure 3.8. What type of...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning

Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Bacterial Infections in Humans; Author: Professor Dave Explains;https://www.youtube.com/watch?v=FeFKAl9KyMg;License: Standard Youtube License