Campbell Biology: Custom Edition
18th Edition
ISBN: 9781323717271
Author: Urry, Cain, Wasserman, Minorsky, Reece
Publisher: PEARSON C
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 19.2, Problem 2CC
MAKE CONNECTIONS Ø Compare the CRISPR-Cas system to the miRNA system discussed in Concept 18.3, including their mechanisms and their functions.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Consider the following sequence fragment of an mRNA. Which of the miRNAS below would be competent for gene silencing?
5'-AUGCAAGCAUUGGCCAAGCUU-3'
5'-AUGCAAGCAUUGGCCAAGCUU-3
5'-UACGUUCGUAACCGGUUCGAA-3'
5'-AAGCUUGGUUAAUGCUUGCAU-3'
5'-UUCGAACCAAUUACGAACGUA-3'
3'-UUCGAACCAAUUACGAACGUA-5
3'-AUGCAAGCAUUGGCCAAGCUU-5'
What are the differences between miRNA and siRNA?
(Select all that apply.)
OmiRNAs carry the genetic information from the DNA in
the nucleus directly to the cytoplasm, and siRNAs are
involved in the degradation of specific mRNA molecules.
miRNAs are from 22 to 30 bases long, and siRNAs are 22
bases long.
O miRNAs carry the genetic information from the DNA in
the nucleus directly to the cytoplasm, and siRNAs help
with the processing of the initial mRNA transcribed from
DNA into a mature form.
miRNAs prevent translation of certain mRNAs, and
siRNAs are involved in the degradation of specific mRNA
molecules.
miRNAs are 20 to 22 bases long, and siRNAs are from 20
to 30 bases long.
Need answer in short and ASAP
Chapter 19 Solutions
Campbell Biology: Custom Edition
Ch. 19.1 - Prob. 1CCCh. 19.1 - MAKE CONNECTIONS Bacteriophages were used to...Ch. 19.2 - Compare the effect on the host cell of a lytic...Ch. 19.2 - MAKE CONNECTIONS Compare the CRISPR-Cas system to...Ch. 19.2 - Prob. 3CCCh. 19.2 - Why is HIV called a retrovirus?Ch. 19.2 - Prob. 5CCCh. 19.3 - Describe two ways in which a preexisting virus can...Ch. 19.3 - Contrast horizontal and vertical transmission of...Ch. 19.3 - WHAT IF? TMV has been isolated from virtually all...
Ch. 19 - Are viruses generally considered living or...Ch. 19 - Prob. 19.2CRCh. 19 - Prob. 19.3CRCh. 19 - Which of the following characteristics,...Ch. 19 - Emerging viruses arise by (A) mutation of existing...Ch. 19 - Prob. 3TYUCh. 19 - Prob. 4TYUCh. 19 - Prob. 5TYUCh. 19 - DRAW IT Redraw Figure 19.8 to show the replicative...Ch. 19 - EVOLUTION CONNECTION The successof some viruses...Ch. 19 - SCIENTIFIC INQUIRY When bacteria infect an animal,...Ch. 19 - WRITE ABOUT A THEME: ORGANIZATION While viruses...Ch. 19 - Prob. 10TYU
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Describe how RBPs can prevent miRNAs from degrading an RNA molecule.arrow_forward. In many bacterial species, regulatory sRNAs havebeen identified by transcriptome sequencing (RNASeq). How do researchers know that the small RNAspecies identified by cDNA sequencing are regulatorysRNAs rather than fragments of longer mRNAs?arrow_forwardImagine Cas9 used a 30 base RNA molecule instead of a 20 base molecule. How often will it cut? Hint: each base (A,G,T,C) is equally likelyarrow_forward
- You are a research scientist studying miRNA processing. You currently know everything about the pathway except for one detail: whether Dicer resides in the nucleus or in the cytoplasm. You have an experiment setup where you have a miRNA that completely complements the GFP (green fluorescent protein) gene in a model yeast cell. You plan to mutate Exportin 5 and make it dysfunctional, then you will inject synthetic pre-miRNA either in its double strand form or its hairpin single strand form into the cell. Should you inject the synthetic pre-miRNA into the nucleus or the cytoplasm? a) b) If you inject hairpin single stranded pre-miRNA into the appropriate location in the cell, what color do you expect the yeast to be if Dicer is in the nucleus? What color would the yeast be if Dicer is in the cytoplasm? Briefly explain your reasoning.arrow_forwardCompare and contrast anti-miRNA oligonucleotides, locked nucleicacids (LNAs), and antagomirs, which may eventually be used to treat certain forms of cancer.arrow_forwardThe piRNA, miRNA and RNAi pathways are all similar and may have evolved from some early function of small RNAs in an ancestral cell. The piRNA pathway seems a bit unique in several ways however. Name two distinct features that are unique to the piRNA pathway when compared to the miRNA and the RNAi pathwaarrow_forward
- 1) Assuming that all the appropriate accessory proteins (switches) and RNA polymerase is presence, transcribe this gene i.e a) write out that sequence of the mRNA you will make from turning on this gene Z b) Label the 5' and 3' ends of the mRNA made 2) Assuming there is a ribosome binding site for the mRNA you just synthesized in the previous question, write out the amino acid sequence of this protein Z that is made (Using the genetic discord Mary provided) The following double stranded DNA sequence provided contains a gene for making proteins Z. The regulatory sequence or switch is indicated by the Red colored sequences. Start of transcription is 10 nucleotide after the switch sequence beginning at the Blue region. Answer the following questions. 3'. TATGACAACGCGTATAATCCAGTCGGTTTGGGGGTAATTGGGCGTCCTACGTCTACAAAGGGTCGTT ААТAGCATTTAGGCGTсTGCCTTTTAТCGTTTATCGAATTтсТТАТTАTTTTAATстCсT...5 5'.ATACTGTTGCGCATATTAGGTCAGCCAAACCCCCATTAACCCGCAGGATGCAGATGTTTCCCAGCAAT…arrow_forwardCreate a hybrid cDNA-mRNA molecule using reverse transcriptase and oligo-dT primer, what is step 3 of making a cDNA library?arrow_forwardA scientist sequencing itiRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this itiRNA makes when it is translated?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
What Is A Virus ? ; Author: Peekaboo Kidz;https://www.youtube.com/watch?v=YS7vsBgWszI;License: Standard YouTube License, CC-BY