Pearson eText for Visual Anatomy & Physiology -- Instant Access (Pearson+)
Pearson eText for Visual Anatomy & Physiology -- Instant Access (Pearson+)
3rd Edition
ISBN: 9780137503100
Author: Frederic Martini, William Ober
Publisher: PEARSON+
bartleby

Concept explainers

Question
Book Icon
Chapter 19.1, Problem 7R

A.

Summary Introduction

To describe: The reason that valves are located in veins but not in the arteries.

Introduction: The blood is pumped by the heart in sequence. The flow of blood is carried out through a network of blood vessels extending between the heart and the peripheral tissues. This includes arteries, capillaries, and veins of the systemic and pulmonary circuits.

B.

Summary Introduction

To describe: The way in which blood pressure is maintained in veins to counter the gravity’s force.

Blurred answer
Students have asked these similar questions
What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?

Chapter 19 Solutions

Pearson eText for Visual Anatomy & Physiology -- Instant Access (Pearson+)

Ch. 19.1 - Prob. 3LOCh. 19.1 - Prob. 4LOCh. 19.1 - Prob. 1ICh. 19.1 - Prob. 2ICh. 19.1 - Prob. 1SRCh. 19.1 - Prob. 2SRCh. 19.1 - Prob. 3SRCh. 19.1 - Prob. 4SRCh. 19.1 - Prob. 5SRCh. 19.1 - Prob. 6SRCh. 19.1 - Prob. 7SRCh. 19.1 - Prob. 8SRCh. 19.1 - Prob. 9SRCh. 19.1 - Prob. 10SRCh. 19.1 - Prob. 11SRCh. 19.1 - Prob. 12SRCh. 19.1 - Prob. 13SRCh. 19.1 - Prob. 14SRCh. 19.1 - Prob. 15SRCh. 19.1 - Prob. 16SRCh. 19.1 - Prob. 17SRCh. 19.1 - Prob. 18SRCh. 19.1 - Prob. 19SRCh. 19.1 - Prob. 20SRCh. 19.1 - Prob. 21SRCh. 19.2 - Prob. 1RCh. 19.2 - Prob. 2RCh. 19.2 - Prob. 3RCh. 19.2 - Prob. 4RCh. 19.2 - Prob. 5RCh. 19.2 - Prob. 6RCh. 19.2 - Prob. 7RCh. 19.2 - Prob. 8RCh. 19.2 - Prob. 9RCh. 19.2 - Prob. 10RCh. 19.2 - Prob. 11RCh. 19.2 - Prob. 12RCh. 19.2 - Prob. 13RCh. 19.2 - Prob. 14RCh. 19.2 - Prob. 15RCh. 19.2 - Prob. 16RCh. 19.2 - Prob. 17RCh. 19.2 - Prob. 18RCh. 19.2 - Prob. 19RCh. 19.2 - Prob. 20RCh. 19.2 - Prob. 1LOCh. 19.2 - Prob. 2LOCh. 19.2 - Prob. 3LOCh. 19.2 - Prob. 4LOCh. 19.2 - Prob. 5LOCh. 19.2 - Prob. 6LOCh. 19.2 - Prob. 7LOCh. 19.2 - Prob. 8LOCh. 19.2 - Prob. 9LOCh. 19.2 - Prob. 1ICh. 19.2 - Prob. 2ICh. 19.2 - Prob. 3ICh. 19.2 - Prob. 4ICh. 19.2 - Prob. 1SRCh. 19.2 - Prob. 2SRCh. 19.2 - Prob. 3SRCh. 19.2 - Prob. 4SRCh. 19.2 - Prob. 5SRCh. 19.2 - Prob. 6SRCh. 19.2 - Prob. 7SRCh. 19.2 - Prob. 8SRCh. 19.2 - Prob. 9SRCh. 19.2 - Prob. 10SRCh. 19.2 - Prob. 11SRCh. 19.2 - Prob. 12SRCh. 19.2 - Prob. 13SRCh. 19.3 - Prob. 1RCh. 19.3 - Prob. 2RCh. 19.3 - Prob. 3RCh. 19.3 - C. Trace a drop of blood through the lungs,...Ch. 19.3 - Prob. 5RCh. 19.3 - Prob. 6RCh. 19.3 - Prob. 7RCh. 19.3 - Prob. 8RCh. 19.3 - Prob. 9RCh. 19.3 - Prob. 10RCh. 19.3 - Prob. 11RCh. 19.3 - Prob. 12RCh. 19.3 - Prob. 13RCh. 19.3 - Prob. 14RCh. 19.3 - Prob. 15RCh. 19.3 - Prob. 16RCh. 19.3 - Prob. 17RCh. 19.3 - Prob. 18RCh. 19.3 - Prob. 19RCh. 19.3 - Prob. 20RCh. 19.3 - Prob. 21RCh. 19.3 - Prob. 22RCh. 19.3 - Prob. 23RCh. 19.3 - Prob. 24RCh. 19.3 - Prob. 25RCh. 19.3 - Prob. 1LOCh. 19.3 - Prob. 2LOCh. 19.3 - Prob. 3LOCh. 19.3 - Prob. 4LOCh. 19.3 - Prob. 5LOCh. 19.3 - Prob. 6LOCh. 19.3 - Prob. 7LOCh. 19.3 - Prob. 8LOCh. 19.3 - Prob. 9LOCh. 19.3 - Prob. 10LOCh. 19.3 - Prob. 11LOCh. 19.3 - Prob. 1ICh. 19.3 - Prob. 2ICh. 19.3 - Prob. 3ICh. 19.3 - Prob. 4ICh. 19.3 - Prob. 1SRCh. 19.3 - Prob. 2SRCh. 19.3 - Prob. 3SRCh. 19.3 - Prob. 4SRCh. 19.3 - Prob. 5SRCh. 19.3 - Prob. 6SRCh. 19.3 - Prob. 7SRCh. 19.3 - Prob. 8SRCh. 19.3 - Prob. 9SRCh. 19.3 - Prob. 10SRCh. 19.3 - Prob. 11SRCh. 19.3 - Prob. 12SRCh. 19.3 - Prob. 13SRCh. 19.3 - Prob. 14SRCh. 19.3 - Prob. 15SRCh. 19.3 - Label the major veins in the diagram below. 16...Ch. 19.3 - Prob. 17SRCh. 19.3 - Prob. 18SRCh. 19.3 - Prob. 19SRCh. 19.3 - Prob. 20SRCh. 19.3 - Prob. 21SRCh. 19.3 - Prob. 22SRCh. 19.3 - Prob. 23SRCh. 19.3 - Prob. 24SRCh. 19.3 - Prob. 25SRCh. 19.3 - Prob. 26SRCh. 19.3 - Prob. 27SRCh. 19.3 - Prob. 28SRCh. 19 - Prob. 1CRQCh. 19 - Prob. 2CRQCh. 19 - Prob. 3CRQCh. 19 - Prob. 4CRQCh. 19 - Prob. 5CRQCh. 19 - Prob. 6CRQCh. 19 - Prob. 7CRQCh. 19 - Prob. 8CRQCh. 19 - Prob. 9CRQCh. 19 - Prob. 10CRQCh. 19 - Prob. 11CRQCh. 19 - Prob. 12CRQCh. 19 - Prob. 13CRQCh. 19 - Prob. 14CRQCh. 19 - Prob. 15CRQCh. 19 - Prob. 16CRQCh. 19 - Prob. 17CRQCh. 19 - Prob. 18CRQCh. 19 - Prob. 19CRQCh. 19 - Prob. 1CICh. 19 - Prob. 2CICh. 19 - Prob. 3CI
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
Recommended textbooks for you
Text book image
Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
Text book image
Body Structures & Functions
Biology
ISBN:9781285695495
Author:Scott
Publisher:Cengage
Text book image
Basic Clinical Laboratory Techniques 6E
Biology
ISBN:9781133893943
Author:ESTRIDGE
Publisher:Cengage
Text book image
Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning
Text book image
Fundamentals of Sectional Anatomy: An Imaging App...
Biology
ISBN:9781133960867
Author:Denise L. Lazo
Publisher:Cengage Learning
Text book image
An Illustrated Guide To Vet Med Term
Biology
ISBN:9781305465763
Author:ROMICH
Publisher:Cengage