A. Explanation The pressures in the arterial system are found to be high enough to keep the movement of blood away from the heart and through the capillaries and arteries. The blood pressure in the venous system is found to be too low in order to prevent the backward movement of blood toward the heart... B. Summary Introduction To describe: The way in which blood pressure is maintained in veins to counter the gravity’s force.

Pearson eText for Visual Anatomy & Physiology -- Instant Access (Pearson+)

3rd Edition

ISBN: 9780137503100

Author: Frederic Martini, William Ober

Publisher: PEARSON+

See similar textbooks

Concept explainers

Thoracic and Abdominal Veins

Thorax is the region that is referred to as the trunk’s superior part and is situated between the region of the abdomen and neck. On the other hand, the abdomen is the region that is situated between the pelvis and thorax. The thoracic veins and veins of…

Ovarian and Uterine Cycles

Two cycles are engaged with the guideline of a lady's richness: the ovarian cycle and the uterine cycle (additionally called the period). The ovarian cycle is a cycle that controls a lady's fruitfulness. The ovary of the follicle that produces an egg eve…

Structure and Function of The Vertebral Column

The vertebral column (also known as the backbone or spine) is a tall, thin bone that runs from the base of the spine to the pelvis and is located dorsally. It protects the spinal cord and serves as a vital connection point for a variety of muscle groups.

Axial Versus Appendicular Muscles

Axial muscle is one of the skeletal muscles that are found in the trunk and the head regions of the human body. They include the muscles of the tail and eyeball too. Axial muscles are originated from the axial skeleton that composes the bones in the neck…

Motor Units In Skeletal Muscles

A motor unit is a functional unit of muscle contraction and each muscle in the body includes many motor units. It consists of alpha motor neurons, axons, and muscle fibers. Each motor neuron comes from the anterior horn of the spinal cord and supplies ne…

Muscle And Nervous Tissues

A tissue is a group of similar cells that are organized to perform one or more specific functions. Tissues are classified into four different types based on their morphology and function: connective tissue, nervous tissue, muscle tissue, and epithelial t…

Gastroileal Reflex

Gastroileal reflex is a reflexstimulated by the opening of the ileocecal valve, pushing the digested material from the ileum present in the small intestine to the large intestineaccompanied by a desire to defecate. It is the third type of gastrointestina…

Synaptic Knob

The synaptic knobs (synaptic terminals) are the ends of the neuron that are associated with the signaling of the neuronal impulses. The neurotransmitters enclosed in the vesicle fuse with these synaptic terminals and the chemical within the vesicle is re…

Blood Vessels Of The Head And Neck

The carotid arteries are the primary blood vessels that supply the blood to the neck and regions of the neck, brain, and face. Among the carotid arteries, two are positioned on the left and the right. When it comes to the neck, there are two segmental re…

Suspensory Ligament

A suspensory ligament is a group of fibrous membranes or any tissues that puts up or suspends a particular organ or a part of the body.

Receptive Relaxation

Receptive relaxation refers to the relaxation of the muscles in the upper portion of the stomach that occurs before the food particles enter the esophagus. This receptive relaxation helps in the movement of the food. This receptive relaxation is achieved…

Structure And Function of the Appendicular Skeleton

In biology, the skeletal system makes up the framework of human bodies structurally and has two main subdivisions-

Structure And Function Of The Axial Skeleton

The skeletal system present in our body is distinguished as the axial and appendicular skeleton. The appendicular skeleton has upper and lower limb bones. The axial skeleton is the bones that are present in the upper part of the body. The axial skeleton …

Types Of Joints

A joint is the point where two or more bones are connected. Joints hold the bones together and help in movement of the skeletal system in different directions. It is also called an articular surface. These are present to allow different types of movement…

Dual Innervation

Dual innervation is the instruction that an organ receives from both sympathetic and parasympathetic systems. Most of the organs in our body are innervated by both divisions of the autonomic nervous system (ANS). For example, the vagal parasympathetic in…

Circulatory System

The circulatory system serves to deliver oxygen to different regions of the body. The oxygen that is inhaled diffuses through the air sacs into the blood where it binds to the hemoglobin component of the blood and transmitted to different regions of the …

Human Excretory System

The expulsion of nitrogenous wastes (non-gaseous) such as urea, ammonia, uric acid with water, some salts, and pigments out of the body is termed excretion. It helps to maintain the homeostatic conditions (constant internal composition) in the body. Diff…

Structure And Function Of The Lymphatic System

The lymphatic system is a network of complex tissues and organs that aid in the expulsion of the toxins and waste materials from the body. The role of this system is to guard the body from foreign invaders and help to maintain the body fluid level.

Interstitial And Appositional Growth

Growth in bones occurs in two ways either longitudinally or increase in the width of bone size. This increase in the length size of the bone is referred as interstitial growth whereas the increase in the preexisting diameter or width size of bones is ref…

Nail Structure And Function

The claw-shaped keratinous plate positioned at the edge of the finger and toes are called the nails. These structures are identified mainly in the primates. The toenails and the fingernails are composed of tough guarding protein known as alpha-keratin, w…

Hair Structure And Function

The hair is considered as the characteristic feature of mammals and it possesses numerous functions including providing protection against external factors and dealing with the production of pheromones, apocrine sweat, and sebum. It is found to have a gr…

Hearing And Equilibrium

The ear is the organ that helps in hearing, which is the modification of sound waves from any source into neural signals that the brain could process. The ears aid in detecting and processing sound and help maintain an overall equilibrium of the being. E…

Muscular System

The human body is majorly classified into eleven organ systems. The muscular system is one among them which is specifically responsible for movements. The muscular system is specifically made up of specialized cells termed muscle cells. The significant f…

Structure And Function Of The Pectoral Girdle

A pair of structures that connect the axial skeleton to the upper limbs is known as the pectoral girdle. It forms articulations, or joints, with the upper limbs, each consisting of a clavicle and scapula.

Muscular System Disorders

The human muscular system disorder influences the most important part of the human body- the muscle. It is essential as it provides to and fro movement to the body and nerves. Various types of disorders and illnesses from an irregularity of this movement…

Human Body Systems

The human body performs various functions with the coordination of several systems. Our heart and lungs are working all the time, even when we are at rest. There is an assortment of different functions that happen inside our bodies. With the advancement …

Human Reproductive System

Reproduction defines a biological process that brings new offspring into life from the parents. In humans, reproduction is the process by which gametes from both male and female parents’ gonad fuse to produce a fetus in the female’s body (uterus). The ma…

Cephalization of Brain

Cephalization is a steady evolution process through which the mouth, sense organs, nervous, and sensory tissues become concentrated at the anterior part and make the head region. Cephalization word is derived from the Greek word Kephalē, which means head…

Bone Marrow

The spongy tissue within the bones, like the pelvic and leg bones, is called bone marrow. The bone marrow consists of stem cells. These cells can differentiate into red blood cells that transport oxygen across the body, white blood cells that combat infe…

Bones Of The Pelvic Girdle

A single bone, the hip bone or coxal bone (coxal = “hip”), forms the pelvic girdle (hip girdle), which acts as the attachment point for each lower limb. Each hip bone is firmly attached to the axial skeleton through its connection to the sacrum of the ve…

Thoracic and Abdominal Arteries

The thoracic artery is also known as the internal mammary artery. It supplies the breasts and the anterior chest wall. There are two internal arteries, the right and left artery, which are situated anterior to the chest wall on either side of the sternum…

The Skeletal Muscle Contraction Cycle

The skeletal muscle contraction cycle is activated by calcium ions from the sarcoplasmic reticulum. The calcium ions bind to the troponin, which reveals the active site on actin by removing tropomyosin. It helps the myosin head to bind the actin. The ade…

Integumentary System

The integumentary system encompasses a set of organs developing the external most layer of the body, where the skin and the appendages are found to function as a physical barrier for preventing the entry of pathogenic microbes and hazardous substances fr…

Bone Formation And Development

Bone is the connective tissue that functions to provide support and protection to various organs of the body. It comprises mineral salts and collagen fibers. The formation of new bones is called ossification. The process of ossification is essential for …

Blood Flow Through The Kidney

Kidneys are the primary organs that eliminate all the waste products from within the body. The acids produced in the cells as a result of metabolism are removed by the kidneys. Kidneys help maintain the salt, water, and minerals like potassium, calcium, …

Body Cavities

The potential spaces detected in the body of the animal is called the body cavity. The structure is found to possess organs and numerous structures and also contain fluid. The dorsal and the ventral body cavities are the largest body cavities found in t…

Sexual Reproduction

Biology is the study of living organisms. It includes various processes occurring in these organisms, like digestion, reproduction, and excretion. Reproduction is a process of producing offspring or new organisms by single or two parents. When reproducti…

The Senses

The senses connect an organism to the world. A person can know, both consciously and otherwise, what goes on around him and within him through complex systems that send signals through a maze of brain circuits. These begin with the cells that respond to …

Nervous and Endocrine Systems

Any human body system is composed of a cluster of organs or cells that perform together to execute or maintain homeostasis. For example, the nervous system receives sensory input from the sensory receptors' environment, processes those signals, and direc…

Gustation

Gustation is the perception of the taste or flavors of the food ingested, by the gustatory system. The process of taste occurs when the chemicals present in food or other substances react with the taste receptor cells present in the taste buds. The taste…

Eye Anatomy And Vision

The eye is the organ that helps in seeing and perceiving the world around. The eye, along with its entire system of muscles and nerves, helps in providing a mental representation of the environment. Thus, the eye contributes in the acuity to navigate pro…

Respiratory System

It is a process by which living organisms produce energy by the oxidation of complex organic substances, typically with the intake of oxygen and the release of carbon dioxide.

The Cardiopulmonary System

The cardiopulmonary system is responsible for the transportation of gases throughout the body. It comprises the heart, blood, and blood vessels. Each component of the cardiopulmonary system plays an important role in maintaining oxygen and carbon dioxide…

Digestive System

The digestive system consists of the liver and gallbladder, and gastrointestinal tract (also known as the G.I. tract). The G.I. tract is a series of hollow organs connected by a long, twisted tube that runs from the mouth to the anus. The mouth, esophagu…

The Digestive and Excretory Systems

The human body consists of several systems that help it to perform several essential life processes. The digestive system and the excretory system are some of the many systems that make the human body fit to its environment.

Hormonal Regulation

The hormones are generated in the body for controlling various biochemical reactions, which are concerned with the maintenance of homeostasis. The hormones regulate the physiological and behavioral processes of the body. The reactions including respirati…

Temporal Summation

The additive effect of multiple electrical impulses on a neuromuscular junction (junction between a nerve cell and a muscle cell), is referred to as summation in physiology. Individually, the stimuli are unable to elicit a response, but when combined, th…

Question

Chapter 19.1, Problem 7R

Summary Introduction

To describe: The reason that valves are located in veins but not in the arteries.

Introduction: The blood is pumped by the heart in sequence. The flow of blood is carried out through a network of blood vessels extending between the heart and the peripheral tissues. This includes arteries, capillaries, and veins of the systemic and pulmonary circuits.

Summary Introduction

To describe: The way in which blood pressure is maintained in veins to counter the gravity’s force.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Chapter 19.1, Problem 6R

Chapter 19.1, Problem 8R

Students have asked these similar questions

What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?

Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks

Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?

Chapter 19 Solutions

Pearson eText for Visual Anatomy & Physiology -- Instant Access (Pearson+)

Ch. 19.1 - Prob. 1R Ch. 19.1 - Prob. 2R Ch. 19.1 - Prob. 3R Ch. 19.1 - Prob. 4R Ch. 19.1 - Prob. 5R Ch. 19.1 - Prob. 6R Ch. 19.1 - Prob. 7R Ch. 19.1 - Prob. 8R Ch. 19.1 - Prob. 1LO Ch. 19.1 - Prob. 2LO

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Solution Summary: The author explains the reason that valves are located in veins but not in the arteries.

Concept explainers

To describe: The way in which blood pressure is maintained in veins to counter the gravity’s force.

Want to see the full answer?

Chapter 19 Solutions