
To draw:
A representative epi curve (time versus the number of people ill) depicting a propagated and a common-source epidemic.
Introduction:
On the occurrence of an outbreak, descriptive studies are conducted by the epidemiologists. In the descriptive study, data is collected that characterize the occurrence, focuses on “time, person and palace” of the outbreak of disease. This helps in listing the possible and potent risk factors which resulted in the spread of the disease.
The data collected from the descriptive studies are represented is in the form of a graph. This graph is called an “epi” curve (epi refers to the epidemic curve), this helps an individual to study the pattern of spreading the disease.

Want to see the full answer?
Check out a sample textbook solution
Chapter 19 Solutions
Nester's Microbiology: A Human Perspective
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forward
- Biology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forward
- Health Safety And Nutrition F/Young ChildHealth & NutritionISBN:9781305144767Author:MAROTZPublisher:CengageCase Studies In Health Information ManagementBiologyISBN:9781337676908Author:SCHNERINGPublisher:Cengage
- Comprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage Learning
