
A.
To determine: The probable cause of the man’s symptoms.
Introduction. In terms of body shape and image AAS users also undergo a condition called muscle dysmorphia. This is also known as reverse anorexia, where the individual starts to perceive his/her body as too small, too muscular or insufficiently lean.
A.

Explanation of Solution
The chest pain is generally considered as a first sign of an underlying heart condition. The other symptoms like shortness of breath, high pulse rate can also be indicative of oxygen and blood not reaching properly to the heart. The elevated ST segment with T wave inversion implies that the individual is undergoing myocardial damage due to lack of oxygen reaching the heart. The myocardial damage can be diagnosed as heart attack because of the elevated creatine enzyme from heart muscles (CK-MB) and troponin I which is a cardiac enzyme and the elevation of this enzyme is indicative of heart attack.
B.
To determine: The origin of left arm pain and increased heart rate.
Introduction: A disorder is the dysregulation or disruption of the structure of the body or function. This is due to the effect of a pathological organism or condition inside the body.
B.

Explanation of Solution
The presence of a clot or plaque can cut off the oxygen supply of the lungs to the heart. Left arm pain is one of the common symptoms of heart attack. The nerves that branch from heart are present on the right side and the arteries that bring blood to the heart are on left side. The hindrance in the blood reaching the heart can cause pain in the left side and also increase blood pressure due to increased stress on heart to pump blood in the body. The cardiac enzymes activate parts of vagus nerve that is attached to the heart add triggers the hindbrain to produce nausea like effects.
C.
To determine: The significance of the ST segment and elevation in troponin I levels.
Introduction: Diseases like cardiovascular disorders, type II diabetes cannot be classified under one cause, as they are a result of several abnormalities like excess weight, obesity, sedentary lifestyle, high-cholesterol diet and so on. These ailments are interconnected and lead to the gradual development of chronic diseases.
C.

Explanation of Solution
The ST elevation is considered important if the vertical distance inside the ECG trace and the baseline at a point 0.04 seconds after the presence of J-point is at least 0.1 microvolt’s. This represents the interval between the ventricular depolarization anddepolarization and so the elevation is an abnormality that is linked to myocardial ischemia or infarction. The elevation of the cardiac troponin I level indicates the presence of an underlying myocardial injury. The elevation of the troponin enzyme can also indicate the acute pulmonary embolism, heart failure, myocarditis or end stage renal disease.
D.
To determine: The relation between the actions of aspirin, morphine, and oxygen to treatment of man’s condition.
Introduction: Among the blood vessels, the pulmonary artery, vein and aorta form the largest and most important vessel system the cardiovascular system is made of different components. The heart constitutes the primary organs of the system and the arteries, veins, and blood capillariesfrom the associated structures of the cardiovascular system.
D.

Explanation of Solution
Aspirin is majorly used as an analgesic to treat pain from aches and fever. Aspirin is also used as a blood thinner to prevent the blood from clotting during myocardial infarction. Morphine is a pain reliever that helps to reduce the pain in the left arm and in the chest arising from heart attack. Oxygen is given to meet the body’s requirements for oxygen as the blood from the heart is interrupted to reach the body’s tissues from clot or plaque in the arteries.
Want to see more full solutions like this?
Chapter 19 Solutions
Essentials of Pathophysiology: Concepts of Altered States
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





