
Seeley's Anatomy & Physiology
11th Edition
ISBN: 9780077736224
Author: Cinnamon VanPutte, Jennifer Regan, Andrew F. Russo Dr., Rod R. Seeley Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Question
Chapter 18.4, Problem 37AYP
Summary Introduction
To determine:
The factors that can cause hyperparathyroidism and describe the symptoms.
Introduction:
The secretion of parathyroid hormone (PTH) is triggered by a decrease in blood calcium ions levels, and inhibition of PTH secretion is triggered by an elevation in blood calcium ions levels. In this way, blood calcium levels are maintained within a normal range.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Biology
You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Chapter 18 Solutions
Seeley's Anatomy & Physiology
Ch. 18.1 - Prob. 1AYPCh. 18.1 - Prob. 2AYPCh. 18.2 - Prob. 3AYPCh. 18.2 - Prob. 4AYPCh. 18.2 - How does the hypothalamus regulate the secretion...Ch. 18.2 - Prob. 6AYPCh. 18.2 - Prob. 7AYPCh. 18.2 - Prob. 8AYPCh. 18.2 - Prob. 9AYPCh. 18.2 - Prob. 10AYP
Ch. 18.2 - Prob. 11AYPCh. 18.2 - Prob. 12AYPCh. 18.2 - Prob. 13AYPCh. 18.2 - What effects do stress, blood amino acid levels,...Ch. 18.2 - Describe the effects of GH on its target tissues.Ch. 18.2 - Prob. 16AYPCh. 18.2 - Prob. 17AYPCh. 18.2 - Prob. 18AYPCh. 18.2 - For each of the following hormones secreted by the...Ch. 18.2 - Prob. 20AYPCh. 18.2 - What is a gonadotropin? Name two...Ch. 18.3 - Prob. 22AYPCh. 18.3 - Prob. 23AYPCh. 18.3 - How are the thyroid hormones transported in the...Ch. 18.3 - Prob. 25AYPCh. 18.3 - Starting in the hypothalamus, explain how chronic...Ch. 18.3 - Prob. 27AYPCh. 18.3 - Prob. 28AYPCh. 18.3 - Prob. 29AYPCh. 18.3 - What conditions cause hyperthyroidism? Describe...Ch. 18.3 - Prob. 31AYPCh. 18.4 - Prob. 32AYPCh. 18.4 - Prob. 33AYPCh. 18.4 - Prob. 34AYPCh. 18.4 - Prob. 35AYPCh. 18.4 - What can cause hypoparathyroidism?Describe the...Ch. 18.4 - Prob. 37AYPCh. 18.5 - Where are the adrenal glands located? Describe the...Ch. 18.5 - Name two hormones secreted by the adrenal medulla,...Ch. 18.5 - Prob. 40AYPCh. 18.5 - Prob. 41AYPCh. 18.5 - Name the target tissue ofaldosterone, and list...Ch. 18.5 - Prob. 43AYPCh. 18.5 - Prob. 44AYPCh. 18.5 - List the possible causes of hypersecretion of...Ch. 18.5 - Prob. 46AYPCh. 18.6 - Prob. 47AYPCh. 18.6 - Prob. 48AYPCh. 18.6 - How does insulin affect the satiety center of the...Ch. 18.6 - Prob. 50AYPCh. 18.6 - Prob. 51AYPCh. 18.7 - Prob. 52AYPCh. 18.7 - Prob. 53AYPCh. 18.7 - Prob. 54AYPCh. 18.8 - Prob. 55AYPCh. 18.8 - List the hormones secreted by the ovaries, and...Ch. 18.8 - What hormones from the anterior pituitary gland...Ch. 18.8 - Prob. 58AYPCh. 18.9 - Prob. 59AYPCh. 18.9 - Prob. 60AYPCh. 18.10 - What hormone is secreted by the thymus? What is...Ch. 18.10 - Prob. 62AYPCh. 18.10 - Prob. 63AYPCh. 18.10 - Prob. 64AYPCh. 18.10 - List examples of paracrine chemical messengers...Ch. 18.10 - Prob. 66AYPCh. 18.11 - Prob. 67AYPCh. 18.11 - Prob. 68AYPCh. 18 - The pituitary gland a. develops from the floor of...Ch. 18 - The hypothalamohypophysial portal system a....Ch. 18 - Prob. 3RACCh. 18 - Prob. 4RACCh. 18 - Prob. 5RACCh. 18 - Prob. 6RACCh. 18 - Prob. 7RACCh. 18 - Hypersecretion of growth hormone a.results in...Ch. 18 - Prob. 9RACCh. 18 - Prob. 10RACCh. 18 - Prob. 11RACCh. 18 - Prob. 12RACCh. 18 - Prob. 13RACCh. 18 - Parathyroid hormone secretion increases in...Ch. 18 - Prob. 15RACCh. 18 - Prob. 16RACCh. 18 - In the condition in which a benign tumor results...Ch. 18 - Which of these is nor a hormone secreted by the...Ch. 18 - Prob. 19RACCh. 18 - Prob. 20RACCh. 18 - Prob. 21RACCh. 18 - Within the pancreas, the pancreatic islets produce...Ch. 18 - Insulin increases a. the uptake of glucose by its...Ch. 18 - Prob. 24RACCh. 18 - Prob. 25RACCh. 18 - Prob. 26RACCh. 18 - Prob. 27RACCh. 18 - Prob. 28RACCh. 18 - Prob. 29RACCh. 18 - Prob. 30RACCh. 18 - Prob. 1CTCh. 18 - Prob. 2CTCh. 18 - A patient complains of headaches and visual...Ch. 18 - Prob. 4CTCh. 18 - Prob. 5CTCh. 18 - Prob. 6CTCh. 18 - Prob. 7CTCh. 18 - Predict some of the consequences of exposure to...Ch. 18 - Katie was getting nervous. At 16, she was the only...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Essentials of Pharmacology for Health ProfessionsNursingISBN:9781305441620Author:WOODROWPublisher:CengageNutrition Through The Life CycleHealth & NutritionISBN:9781337919333Author:Brown, Judith E.Publisher:Cengage Learning,

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Essentials of Pharmacology for Health Professions
Nursing
ISBN:9781305441620
Author:WOODROW
Publisher:Cengage

Nutrition Through The Life Cycle
Health & Nutrition
ISBN:9781337919333
Author:Brown, Judith E.
Publisher:Cengage Learning,
Great Glands - Your Endocrine System: CrashCourse Biology #33; Author: CrashCourse;https://www.youtube.com/watch?v=WVrlHH14q3o;License: Standard Youtube License