
Foundations in Microbiology
10th Edition
ISBN: 9781259705212
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 18.2, Problem 9ELO
Summary Introduction
To determine:
The epidemiology and pathogenesis of the streptococcal species and how they are differentiated in the laboratory.
Introduction:
Streptococcus species are involved in a number of diseases, including skin infections, pharyngitis and systemic infections. Group A Streptococci must be identified at the earliest; laboratory techniques for rapid identification have therefore been developed for this purpose.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 18 Solutions
Foundations in Microbiology
Ch. 18.1 - Prob. 1ELOCh. 18.1 - Describe the ability of S. aureus to withstand...Ch. 18.1 - Prob. 3ELOCh. 18.1 - Summarize the cutaneous, systemic, and toxigenic...Ch. 18.1 - Prob. 5ELOCh. 18.1 - Explain strategies used to prevent and treat...Ch. 18.1 - Prob. 1CYPCh. 18.1 - Discuss why food intoxication in salty foods, such...Ch. 18.1 - Explain how unbroken skin, the phagocytic action...Ch. 18.1 - List the strategies commonly used to prevent and...
Ch. 18.1 - Explain the meanings of the acronyms MRSA, VRE,...Ch. 18.2 - Name the most important human pathogens in the...Ch. 18.2 - Summarize the virulence factors of S. pyogenes, as...Ch. 18.2 - Prob. 9ELOCh. 18.2 - Explain strategies used to prevent and treat...Ch. 18.2 - Relate the pathogenesis and epidemiology of S....Ch. 18.2 - List the clinically significant pathogens in the...Ch. 18.2 - Describe the immediate effects and long-term...Ch. 18.2 - Prob. 8CYPCh. 18.2 - Differentiate between pneumococcal disease...Ch. 18.3 - Name the most important human pathogens in the...Ch. 18.3 - Compare the differences in pathologies of N....Ch. 18.3 - Summarize the pathogenesis and epidemiology of N....Ch. 18.3 - Recall the medically important genera, besides...Ch. 18.3 - Describe the epidemiology and pathology of N....Ch. 18.3 - List the short-term and long-term consequences of...Ch. 18.3 - Prob. 12CYPCh. 18.L1 - Which of the following is/are a pyogenic...Ch. 18.L1 - The coagulase text is used primarily to...Ch. 18.L1 - Prob. 3MCQCh. 18.L1 - The most severe streptococcal diseases are caused...Ch. 18.L1 - 5. Rheumatic fever damages the _______, and...Ch. 18.L1 - ______ hemolysis is the partial lysis of red blood...Ch. 18.L1 - Prob. 7MCQCh. 18.L1 - Which of the following strains of pathogens has...Ch. 18.L1 - Otitis media is a/an _______ infection often...Ch. 18.L1 - Prob. 10MCQCh. 18.L1 - Prob. 11MCQCh. 18.L1 - Prob. 12MCQCh. 18.L1 - Prob. 13MCQCh. 18.L1 - Which infectious agent of those covered in the...Ch. 18.L1 - Prob. 15MCQCh. 18.L1 - Prob. 16MCQCh. 18.L1 - The first step in the clinical diagnosis of...Ch. 18.L1 - Vaccination can provide protection against N....Ch. 18.L1 - In this case, the first step taken to treat...Ch. 18.L1 - Prob. 1WCCh. 18.L1 - What conditions favor staph food poisoning?Ch. 18.L1 - Prob. 3WCCh. 18.L1 - Prob. 4WCCh. 18.L1 - Discuss the apparent pathology at work in...Ch. 18.L1 - Prob. 6WCCh. 18.L1 - a. Compare and contrast the characteristics of...Ch. 18.L2 - You have been handed the problem of diagnosing...Ch. 18.L2 - You have been called upon to prevent outbreaks of...Ch. 18.L2 - Prob. 3CTCh. 18.L2 - Prob. 4CTCh. 18.L2 - Prob. 5CTCh. 18.L2 - Prob. 6CTCh. 18.L2 - Prob. 1VCCh. 18.L2 - Prob. 2VC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Microbiology for Surgical Technologists (MindTap ...BiologyISBN:9781111306663Author:Margaret Rodriguez, Paul PricePublisher:Cengage LearningComprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage Learning
- Essentials of Pharmacology for Health ProfessionsNursingISBN:9781305441620Author:WOODROWPublisher:CengageCase Studies In Health Information ManagementBiologyISBN:9781337676908Author:SCHNERINGPublisher:Cengage

Microbiology for Surgical Technologists (MindTap ...
Biology
ISBN:9781111306663
Author:Margaret Rodriguez, Paul Price
Publisher:Cengage Learning

Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning
Essentials of Pharmacology for Health Professions
Nursing
ISBN:9781305441620
Author:WOODROW
Publisher:Cengage
Case Studies In Health Information Management
Biology
ISBN:9781337676908
Author:SCHNERING
Publisher:Cengage