
Foundations in Microbiology
10th Edition
ISBN: 9781259705212
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Question
Chapter 17.4, Problem 11CYP
Summary Introduction
Introduction:
In immunologic reactions, the Ag-Ab binding is used as a factor to diagnose a disease. But sometimes false positives are obtained. Hence, there is a concept of seropositivity and seronegativity.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 17 Solutions
Foundations in Microbiology
Ch. 17.1 - Describe what is involved in the main categories...Ch. 17.1 - Explain several techniques in specimen collection...Ch. 17.1 - Summarize the main procedures in isolation,...Ch. 17.1 - Summarize the major techniques in identifying and...Ch. 17.1 - Describe the general principles in specimen...Ch. 17.1 - Explain why it is important to prevent microbes...Ch. 17.1 - Summarize the kinds of tests that are used to...Ch. 17.2 - Describe some direct methods of testing a...Ch. 17.2 - Summarize the aims in selection of culture...Ch. 17.2 - Prob. 6ELO
Ch. 17.2 - Describe how flowcharts and comparison tables are...Ch. 17.3 - Explain the different variations on genetic...Ch. 17.3 - Describe what is involved in direct specimen...Ch. 17.3 - Prob. 6CYPCh. 17.3 - Describe the applications of PCR in identification...Ch. 17.4 - Describe the background aims of immunologic...Ch. 17.4 - Identify how antigen-antibody reactions are...Ch. 17.4 - Prob. 11ELOCh. 17.4 - Explain the basic methods behind the Western blot...Ch. 17.4 - Prob. 13ELOCh. 17.4 - What is the basis of serology and serological...Ch. 17.4 - Differentiate between specificity and sensitivity.Ch. 17.4 - Prob. 10CYPCh. 17.4 - Prob. 11CYPCh. 17.4 - Prob. 12CYPCh. 17.4 - Prob. 13CYPCh. 17.4 - Give examples of several tests that employ...Ch. 17.4 - What is meant by complement fixation? What are...Ch. 17.4 - Prob. 16CYPCh. 17.5 - Describe the concepts behind the main types of...Ch. 17.5 - Prob. 15ELOCh. 17.6 - Prob. 16ELOCh. 17.6 - Prob. 17CYPCh. 17.6 - Prob. 18CYPCh. 17.6 - Prob. 19CYPCh. 17.6 - Prob. 20CYPCh. 17.6 - Observing figure 17.17, indicate whether each...Ch. 17.L1 - Multiple Matching. Match each of the following...Ch. 17.L1 - Prob. 2MCQCh. 17.L1 - Prob. 3MCQCh. 17.L1 - Prob. 4MCQCh. 17.L1 - A patient with a _____ titer of antibodies to an...Ch. 17.L1 - Prob. 6MCQCh. 17.L1 - Prob. 7MCQCh. 17.L1 - An example of an in vivo serological test is a....Ch. 17.L1 - Which of the following specimens must be removed...Ch. 17.L1 - Prob. 1CSRCh. 17.L1 - Prob. 2CSRCh. 17.L1 - Prob. 3CSRCh. 17.L1 - Prob. 1WCCh. 17.L1 - Prob. 2WCCh. 17.L1 - Briefly describe the principles and give an...Ch. 17.L1 - Prob. 4WCCh. 17.L1 - Prob. 5WCCh. 17.L1 - Prob. 6WCCh. 17.L2 - Prob. 1CTCh. 17.L2 - Prob. 2CTCh. 17.L2 - Why do some tests for antibody in serum (such as...Ch. 17.L2 - Prob. 4CTCh. 17.L2 - Prob. 5CTCh. 17.L2 - Prob. 6CTCh. 17.L2 - From chapter 3, fig 3.17a (reproduced on the...Ch. 17.L2 - Prob. 2VC
Knowledge Booster
Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningHealth Safety And Nutrition F/Young ChildHealth & NutritionISBN:9781305144767Author:MAROTZPublisher:Cengage

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Health Safety And Nutrition F/Young Child
Health & Nutrition
ISBN:9781305144767
Author:MAROTZ
Publisher:Cengage