
HOLES HUMAN A&P TEXT W CAT LAB BNDL
15th Edition
ISBN: 9781260513882
Author: SHIER
Publisher: MCG/CREATE
expand_more
expand_more
format_list_bulleted
Question
Chapter 17, Problem 47P
Summary Introduction
To describe:
How fatty acids are absorbed and transported.
Introduction:
The tubular organ that extends from stomach’s pyloric sphincter to the large intestine is known as the small intestine. The tiny projections throughout the inner surface of the small intestine are known as Intestinal villi. They increase the surface area greatly which helps in the absorption of nutrients. The fat molecules are digested by pancreatic and intestinal enzymes.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?
Chapter 17 Solutions
HOLES HUMAN A&P TEXT W CAT LAB BNDL
Ch. 17 - Prob. 1PCh. 17 - 2 Which organs constitute the digestive system?
Ch. 17 - 3 Describe the wall of the alimentary canal.
Ch. 17 - Name the types of movements in the alimentary...Ch. 17 - Prob. 5PCh. 17 - Prob. 6PCh. 17 - How does the tongue function as part of the...Ch. 17 - Where are the tonsils located?Ch. 17 - Prob. 9PCh. 17 - How are types of teeth adapted to provide...
Ch. 17 - Prob. 11PCh. 17 - Explain how a tooth is attached to the bone of the...Ch. 17 - Prob. 13PCh. 17 - Prob. 14PCh. 17 - Prob. 15PCh. 17 - Prob. 16PCh. 17 - List the major events of swallowing.Ch. 17 - Prob. 18PCh. 17 - Prob. 19PCh. 17 - Prob. 20PCh. 17 - Why doesn’t the stomach digest itself?Ch. 17 - Prob. 22PCh. 17 - Distinguish among the cephalic, gastric, and...Ch. 17 - Prob. 24PCh. 17 - Prob. 25PCh. 17 - Prob. 26PCh. 17 - Prob. 27PCh. 17 - Prob. 28PCh. 17 - Prob. 29PCh. 17 - List the enzymes in pancreatic juice.Ch. 17 - What are the functions of the enzymes in...Ch. 17 - What regulates secretion of pancreatic juice?Ch. 17 - Locate the liver.Ch. 17 - Review liver functions.Ch. 17 - Prob. 35PCh. 17 - Prob. 36PCh. 17 - Describe the function of the gallbladder.Ch. 17 - How is secretion of bile regulated?Ch. 17 - Prob. 39PCh. 17 - Describe the parts of the small intestine.Ch. 17 - What is the function of an intestinal villus?Ch. 17 - Prob. 42PCh. 17 - Prob. 43PCh. 17 - Prob. 44PCh. 17 - Prob. 45PCh. 17 - Prob. 46PCh. 17 - Prob. 47PCh. 17 - Prob. 48PCh. 17 - Prob. 49PCh. 17 - What stimulus relaxes the ileocecal sphincter?Ch. 17 - Prob. 51PCh. 17 - Prob. 52PCh. 17 - Prob. 53PCh. 17 - Prob. 54PCh. 17 - Prob. 55PCh. 17 - Prob. 56PCh. 17 - Prob. 57PCh. 17 - Prob. 58PCh. 17 - Prob. 59PCh. 17 - Prob. 60PCh. 17 - Prob. 61PCh. 17 - Prob. 1CACh. 17 - Prob. 2CACh. 17 - Prob. 3CACh. 17 - Prob. 4CACh. 17 - Prob. 5CACh. 17 - Prob. 6CACh. 17 - Prob. 7CACh. 17 - Prob. 8CACh. 17 - Prob. 9CACh. 17 - Prob. 10CACh. 17 - Prob. 11CACh. 17 - Prob. 12CACh. 17 - Prob. 13CACh. 17 - Prob. 14CACh. 17 - Describe the locations of the major salivary...Ch. 17 - Prob. 16CACh. 17 - Prob. 17CACh. 17 - Prob. 18CACh. 17 - Prob. 19CACh. 17 - Prob. 20CACh. 17 - Prob. 21CACh. 17 - Prob. 22CACh. 17 - Prob. 23CACh. 17 - Prob. 24CACh. 17 - Prob. 25CACh. 17 - Prob. 26CACh. 17 - Prob. 27CACh. 17 - Prob. 28CACh. 17 - Prob. 29CACh. 17 - Prob. 30CACh. 17 - Prob. 31CACh. 17 - Prob. 32CACh. 17 - Prob. 33CACh. 17 - Prob. 34CACh. 17 - Describe the locations of the parts of the small...Ch. 17 - Prob. 36CACh. 17 - Prob. 37CACh. 17 - Prob. 38CACh. 17 - Prob. 39CACh. 17 - Prob. 40CACh. 17 - Prob. 41CACh. 17 - Prob. 42CACh. 17 - Prob. 43CACh. 17 - Prob. 44CACh. 17 - Prob. 45CACh. 17 - Prob. 46CACh. 17 - Prob. 1IACh. 17 - Prob. 2IACh. 17 - What effect is a before-dinner alcoholic cocktail...Ch. 17 - What type of acid-base imbalance is likely to...Ch. 17 - Prob. 5IA
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forward
- Biology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education

Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Human digestive system - How it works! (Animation); Author: Thomas Schwenke;https://www.youtube.com/watch?v=X3TAROotFfM;License: Standard Youtube License