HUMAN ANATOMY
6th Edition
ISBN: 9781260986037
Author: SALADIN
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Question
Chapter 17, Problem 17.1.10AYLO
Summary Introduction
To analyze:
The meaning of the term pain. The difference between fast pain and slow pain and difference between the somatic pain and visceral pain.
Introduction:
Injury in tissue and noxious stimulation can cause pain and lead to invasive action. It makes an individual conscious of any injurious situation.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Biology
You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Chapter 17 Solutions
HUMAN ANATOMY
Ch. 17.1 - Braille uses symbols composed of dots that are...Ch. 17.1 - Distinguish between general and special senses.Ch. 17.1 - Three schemes of receptor classification were...Ch. 17.1 - Prob. 3BYGOCh. 17.1 - Prob. 4BYGOCh. 17.1 - Prob. 5BYGOCh. 17.1 - Prob. 6BYGOCh. 17.2 - Prob. 1AWYKCh. 17.2 - What is the difference between a lingual papilla...Ch. 17.2 - Prob. 8BYGO
Ch. 17.2 - What part of an olfactory cell bears the binding...Ch. 17.2 - Prob. 10BYGOCh. 17.3 - Prob. 1AWYKCh. 17.3 - What is the benefit of having three auditory...Ch. 17.3 - Prob. 12BYGOCh. 17.3 - How does the brain recognize the difference...Ch. 17.3 - Prob. 14BYGOCh. 17.3 - Prob. 15BYGOCh. 17.4 - Prob. 1AWYKCh. 17.4 - Prob. 2AWYKCh. 17.4 - Prob. 3AWYKCh. 17.4 - Prob. 16BYGOCh. 17.4 - List as many structural and functional differences...Ch. 17.4 - Prob. 18BYGOCh. 17.4 - Prob. 19BYGOCh. 17.5 - Describe the contributions of the first pharyngeal...Ch. 17.5 - Prob. 21BYGOCh. 17.5 - Prob. 22BYGOCh. 17.5 - Prob. 23BYGOCh. 17 - The meaning of sensory receptor and the range of...Ch. 17 - Prob. 17.1.2AYLOCh. 17 - Prob. 17.1.3AYLOCh. 17 - Prob. 17.1.4AYLOCh. 17 - Prob. 17.1.5AYLOCh. 17 - The types of sensory nerve endings considered to...Ch. 17 - Prob. 17.1.7AYLOCh. 17 - Prob. 17.1.8AYLOCh. 17 - Prob. 17.1.9AYLOCh. 17 - Prob. 17.1.10AYLOCh. 17 - Prob. 17.1.11AYLOCh. 17 - Prob. 17.1.12AYLOCh. 17 - Prob. 17.1.13AYLOCh. 17 - The relationship of taste buds to the lingual...Ch. 17 - Prob. 17.2.2AYLOCh. 17 - Prob. 17.2.3AYLOCh. 17 - Prob. 17.2.4AYLOCh. 17 - Prob. 17.2.5AYLOCh. 17 - Prob. 17.2.6AYLOCh. 17 - Prob. 17.2.7AYLOCh. 17 - Prob. 17.3.1AYLOCh. 17 - Prob. 17.3.2AYLOCh. 17 - The parts of the middle ear, including its three...Ch. 17 - Prob. 17.3.4AYLOCh. 17 - The anatomy of the cochlea and the functional...Ch. 17 - Prob. 17.3.6AYLOCh. 17 - How cochlear function enables the brain to...Ch. 17 - Prob. 17.3.8AYLOCh. 17 - The differences between static and dynamic...Ch. 17 - Prob. 17.3.10AYLOCh. 17 - The action of the otolithic membrane in...Ch. 17 - Prob. 17.3.12AYLOCh. 17 - Prob. 17.3.13AYLOCh. 17 - The projection pathways taken by signals of...Ch. 17 - Prob. 17.4.1AYLOCh. 17 - Prob. 17.4.2AYLOCh. 17 - Prob. 17.4.3AYLOCh. 17 - Prob. 17.4.4AYLOCh. 17 - Prob. 17.4.5AYLOCh. 17 - Prob. 17.4.6AYLOCh. 17 - Prob. 17.4.7AYLOCh. 17 - Prob. 17.4.8AYLOCh. 17 - Prob. 17.4.9AYLOCh. 17 - The projection pathways taken by retinal signals...Ch. 17 - Prob. 17.4.11AYLOCh. 17 - Prob. 17.5.1AYLOCh. 17 - Prob. 17.5.2AYLOCh. 17 - Prob. 17.5.3AYLOCh. 17 - How the lens, vitreous body, anterior chamber,...Ch. 17 - Hot and cold stimuli are detected by free nerve...Ch. 17 - Prob. 2TYRCh. 17 - Prob. 3TYRCh. 17 - Prob. 4TYRCh. 17 - The sensory neurons that begin in the spiral organ...Ch. 17 - The spiral organ rests on the tympanic membrane....Ch. 17 - Prob. 7TYRCh. 17 - Prob. 8TYRCh. 17 - Prob. 9TYRCh. 17 - Prob. 10TYRCh. 17 - The most finely detailed vision occurs when an...Ch. 17 - Fibers of the optic nerve come from the...Ch. 17 - A sensory nerve ending specialized to detect...Ch. 17 - The gelatinous membranes of the macula sacculi and...Ch. 17 - Three rows of ____________ in the cochlea have...Ch. 17 - The __________ is a tiny bone that vibrates in the...Ch. 17 - The ___________ of the midbrain receive auditory...Ch. 17 - The apical microvilli of a gustatory cell are...Ch. 17 - Olfactory neurons synapse with mitral cells and...Ch. 17 - Prob. 20TYRCh. 17 - State a meaning of each word element and give a...Ch. 17 - State a meaning of each word element and give a...Ch. 17 - State a meaning of each word element and give a...Ch. 17 - State a meaning of each word element and give a...Ch. 17 - State a meaning of each word element and give a...Ch. 17 - State a meaning of each word element and give a...Ch. 17 - State a meaning of each word element and give a...Ch. 17 - Prob. 8BYMVCh. 17 - State a meaning of each word element and give a...Ch. 17 - Prob. 10BYMVCh. 17 - Briefly explain why each of the following...Ch. 17 - Briefly explain why each of the following...Ch. 17 - Briefly explain why each of the following...Ch. 17 - Briefly explain why each of the following...Ch. 17 - Briefly explain why each of the following...Ch. 17 - Prob. 6WWWTSCh. 17 - Prob. 7WWWTSCh. 17 - Prob. 8WWWTSCh. 17 - Briefly explain why each of the following...Ch. 17 - Briefly explain why each of the following...Ch. 17 - Prob. 1TYCCh. 17 - What type of cutaneous receptor enables you to...Ch. 17 - Predict the consequences of a hypothetical...Ch. 17 - Prob. 4TYCCh. 17 - Prob. 5TYC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Understanding Health Insurance: A Guide to Billin...Health & NutritionISBN:9781337679480Author:GREENPublisher:Cengage
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningMedical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage LearningHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
Understanding Health Insurance: A Guide to Billin...
Health & Nutrition
ISBN:9781337679480
Author:GREEN
Publisher:Cengage

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
Nervous System - Get to know our nervous system a bit closer, how does it works? | Neurology; Author: FreeMedEducation;https://www.youtube.com/watch?v=6O-0CVAgaEM;License: Standard youtube license