Campbell Biology (10th Edition)
10th Edition
ISBN: 9780321775658
Author: Jane B. Reece, Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Robert B. Jackson
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 17, Problem 13TYU
Summary Introduction
To explain: The pattern of Siamese cat’s fur pigmentation due to ‘temperature-sensitive’ mutation in the gene encoding dark fur pigment.
Concept introduction:
Siamese cats have unique fur pigmentation pattern known as ‘colorpoints’. The pattern includes dark ears, face, legs, and tail, while a creamy white shade is seen on the back and belly. They are partial albinos. This is caused due to a ‘temperature-sensitive’ mutation in the gene encoding tyrosinase enzyme required for the melanin production. It does not work at normal body temperatures.
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Which of the following are possible reasons that a cell would regulate its expression of a gene? (Select all that apply.) (a) an increased need for a particular enzyme (b) a decreased need for a particular enzyme (c) increasing temperature in the external environment (d) changing needs as an organism ages (e) death
You are working on a protein for a research project. The protein does not express well in prokaryotic expression systems so you decide to try a eukaryotic system, baker’s yeast, instead. As part of the expression system, you add a signal peptide to the protein so that it will be exported through the endomembrane system to the outside of the yeast cell. This makes purifying the protein much simpler. During the purification, you notice that the protein is heavier than it should be during gel filtration chromatography. This is confirmed by SDS-PAGE. What could be the reason that the protein has gained mass when expressed in the eukaryotic system?
You suspect a protein that is being expressed has been affected by a mutation. When you examine the fully functional protein you find curiously that it still has retained all of its overall function. A friend of yours doing research with you assures you when examining the genetic data a new mutation does in fact exist in this protein. What is the most likely type of mutation that occurred based on this information?
Group of answer choices
frameshift mutation
silent mutation
nonsense mutation
Chapter 17 Solutions
Campbell Biology (10th Edition)
Ch. 17.1 - Prob. 1CCCh. 17.1 - What polypeptide product would you expect from a...Ch. 17.1 - Prob. 3CCCh. 17.1 - Prob. 4CCCh. 17.2 - MAKE CONNECTIONS In a research artide about...Ch. 17.2 - What enables RNA polymerase to start transcribing...Ch. 17.2 - Prob. 3CCCh. 17.3 - Prob. 1CCCh. 17.3 - How is RNA splicing similar to how you would watch...Ch. 17.3 - Prob. 3CC
Ch. 17.4 - What two processes ensure that the correct amino...Ch. 17.4 - Prob. 2CCCh. 17.4 - Prob. 3CCCh. 17.4 - Prob. 4CCCh. 17.4 - WH AT IF? In eukaryotic cells, mRNAs have been...Ch. 17.5 - What happens when one nucleotide pair is lost from...Ch. 17.5 - MAKE CONNECTIONS Individuals heterozygous for the...Ch. 17.5 - WHAT IF? DRAW IT The template strand of a gene...Ch. 17 - Describe the process of gene expression, by which...Ch. 17 - What are the similarities and differences in the...Ch. 17 - What function do the 5' cap and the poly-A tail...Ch. 17 - Prob. 17.4CRCh. 17 - What will be the results of chemically modifying...Ch. 17 - In eukaryotic cells, transcription cannot begin...Ch. 17 - Which of the following is not true of a codon? (A)...Ch. 17 - The anticodon of a particular tRNA molecule is (A)...Ch. 17 - Which of the following is not true of RNA...Ch. 17 - Which component is not directly involved in...Ch. 17 - Using Figure 17.6, identify a 5' 3' sequence of...Ch. 17 - Prob. 7TYUCh. 17 - Would the coupling of the processes shown in...Ch. 17 - Prob. 9TYUCh. 17 - Prob. 10TYUCh. 17 - Prob. 11TYUCh. 17 - Prob. 12TYUCh. 17 - Prob. 13TYU
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Complete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and mutated FGFR3 gene (BOTTOM). Remember, when filling in mRNA, use capital letters only. When filling in amino acids, use three letters, with the first letter capitalized. If you do not use this format, your answer may be marked wrong. DNA CCG TTC GGG GAA ССС MRNA Amino Acid DNA CCG TTC GGG GAA TCC MRNA Amino Acidarrow_forwardYou are studying a mutation in mice, which acts dominantly. Mice that have only one copy of the allele carrying this mutation have a kinky tail phenotype. You identify the gene that the mutation affects and find that the codon that encodes the second amino acid in the predicted protein has been mutated to a stop codon. Would you characterize this mutation as a loss-of-function or a gain-of-function and what specific subtype (hypermorphic, antimorphic, etc. ) within these categories? Explain your reasoning.”arrow_forwardRandom mutations only very rarely result in changes in a protein that improve its usefulness for the cell, yet useful mutations are selected in evolution. Because these changes are so rare, for each useful mutation there are innumerable mutations that lead to either no improvement or inactive proteins. Why, then, do cells not contain millions of proteins that are of no use?arrow_forward
- Please helparrow_forward. The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect on protein function of most substitution muta- tions (single-base changes). We will use the six arginine codons to test this idea. Consider all of the substitutions that could affect all of the six arginine codons. (a) How many total mutations are possible? (b) How many of these mutations are "silent," in the sense that the mutant codon is changed to another Arg codon? (c) How many of these mutations are conservative, in the sense that an Arg codon is changed to a functionally similar Lys codon?arrow_forwardI want clear handwritten solution of all parts ...i will up votearrow_forward
- Please help me, this is from practice, double check your answers, previous tutors got it wrongarrow_forwardMolecular Biology (Biol-L211) Dr. Nole Central Dogma Practice - Processes The general flow of genetic information is diagrammed below. Think carefully about what type of molecule is represented by each item in the diagram and clearly address each of the following. A. Label each structure as mature mRNA, pre-mRNA, protein, or DNA. B. Label each arrow to indicate which is processing, transcription, replication, and translation. C. Identify the general location (on the appropriate molecule) of the promoter sequence and the terminator sequence. D. Identify the specific location of the place where the start codon and stop codon function most directly (i.e., which molecule is actually translated?). E. Where does RNA polymerase bind to begin transcription? F. Where specifically does the ribosome bind to begin translation-i.e., what are the ribosome binding sites (in both prokaryotes and eukaryotes) and where are they found? G. Label each end of the mature mRNA and the polypeptide to correctly…arrow_forwardMolecular Biology (Biol-L211) Dr. Nole Central Dogma Practice - Processes The general flow of genetic information is diagrammed below. Think carefully about what type of molecule is represented by each item in the diagram and clearly address each of the following. A. Label each structure as mature mRNA, pre-mRNA, protein, or DNA. B. Label each arrow to indicate which is processing, transcription, replication, and translation. C. Identify the general location (on the appropriate molecule) of the promoter sequence and the terminator sequence. D. Identify the specific location of the place where the start codon and stop codon function most directly. E. Where does RNA polymerase bind to begin transcription? F. Where specifically does the ribosome bind to begin translation-i.e., what are the ribosome binding sites and where are they found? G. Label each end of the mature mRNA and the polypeptide to correctly specify polarity. (You should use the labels 3', 5', C-terminus, and N-terminus.)arrow_forward
- Beadle and Tatum's experiments led to the "one gene - one enzyme (protein)" hypothesis. In subsequent years, many exceptions to this hypothesis were noted. A molecule of hemoglobin fails to support this hypothesis for which of the following reasons? n eukaryotes, one gene can code form multiple isoforms of a polypeptide. The functional hemoglobin protein is made from multiple polypeptides. Not all enzymes are proteins. Not all genes encode proteins.arrow_forward(a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGCGUUUAAGGACGGUA 3' Amino acids - (Asp Leu Pro Arg Leu Arg Thr Val) (b.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGGAAATCCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGCCUUUAGGGACGGUA 3' Amino acids - (Asp Leu Pro Pro Leu Gly Thr Val) (c.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCTCAAATCCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGAGUUUAGGGACGGUA 3' Amino acids - (Asp Leu Pro Ser Leu Gly Thr Val) (d.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATCCCTCCAT 3¹ Then the mRNA sequence will be, 5' GAUAUUCCGCGUUUAGGGAGGUA 3' Amino acids - (Asp Leu Pro Arg Leu Gly Arg).As the last sequence contains only 2 bases it will not represent any amino acid. question: Choose the types of mutations caused by the changes in parts…arrow_forwardcan you please help me out with this ? Mutations in the IL2RG gene cause approximately 30 percent of severe combined immunodeficiency disorder (SCID) cases in humans. These mutations result in alterations to a protein component of cytokine receptors that are essential for proper development of the immune system. The IL2RG gene is composed of eight exons and contains upstream and downstream sequences that are necessary for proper transcription and translation. Below are some of the mutations observed. For each, explain its likely influence on the IL2RG gene product (assume its length to be 375 amino acids). Nonsense mutation in a coding region Insertion in Exon 1, causing frameshift Insertion in Exon 7, causing frameshift Missense mutation Deletion in Exon 2, causing frameshift Deletion in Exon 2, in frame (g) Large deletion covering Exons 2 and 3arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning