Prescott's Microbiology
10th Edition
ISBN: 9781259281594
Author: Joanne Willey, Linda Sherwood Adjunt Professor Lecturer, Christopher J. Woolverton Professor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 16.8, Problem 1MI
What is the term used to describe a temperate phage genome when it is integrated into the host genome?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 16 Solutions
Prescott's Microbiology
Ch. 16.1 - Retrieve, Infer, Apply List three ways in which...Ch. 16.1 - Compare and contrast the means by which the...Ch. 16.1 - Give examples of intragenic and extragenic...Ch. 16.1 - Retrieve, Infer, Apply Sometimes a point mutation...Ch. 16.1 - Retrieve, Infer, Apply Why might a missense...Ch. 16.2 - How would you screen for a tryptophan auxotroph?...Ch. 16.2 - Why is a small amount of histidine added to the...Ch. 16.2 - Retrieve, Infer, Apply Describe how replica...Ch. 16.2 - Retrieve, Infer, Apply Why are mutant selection...Ch. 16.2 - Retrieve, Infer, Apply Briefly discuss how...
Ch. 16.2 - Design an experiment that selects for mutants of a...Ch. 16.2 - Describe how you would isolate a mutant that...Ch. 16.2 - Prob. 6RIACh. 16.3 - How is mismatch repair similar to DNA polymerase...Ch. 16.3 - How is damaged DNA recognized by the UvrAB...Ch. 16.3 - Prob. 1RIACh. 16.3 - Retrieve, Infer, Apply What role does DNA...Ch. 16.3 - Retrieve, Infer, Apply When E. coli cells are...Ch. 16.3 - Explain how the following DNA alterations and...Ch. 16.4 - An antibiotic-resistance gene located on a...Ch. 16.4 - What are the three mechanisms of horizontal gene...Ch. 16.4 - What four fates can DNA have after entering a...Ch. 16.4 - How does homologous recombination differ from...Ch. 16.5 - What features are common to all types of...Ch. 16.5 - How does a transposon differ from an insertion...Ch. 16.5 - What is simple (cut-and-paste) transposition? What...Ch. 16.5 - What effect would you expect the existence of...Ch. 16.6 - Prob. 1MICh. 16.6 - What is bacterial conjugation and how was it...Ch. 16.6 - For F+, Hfr, and F strains of E. coli, indicate...Ch. 16.6 - Describe how F+ F and Hfr conjugation processes...Ch. 16.6 - Compare and contract F+ F and F F conjugation.Ch. 16.7 - According to this model, what would happen if DNA...Ch. 16.7 - Define transformation and competence.Ch. 16.7 - Describe how transformation occurs in S....Ch. 16.7 - Discuss two ways in which artificial...Ch. 16.8 - What is the term used to describe a temperate...Ch. 16.8 - Compare the number of transducing particles that...Ch. 16.8 - Describe generalized transduction and how it...Ch. 16.8 - What is specialized transduction and how does it...Ch. 16.8 - How might one tell whether horizontal gene...Ch. 16.8 - Why doesnt a cell lyse after successful...Ch. 16.8 - Describe how conjugation, transformation, and...Ch. 16.9 - Why cant the gal and bio genes be transduced by...Ch. 16.9 - As a replicative transposon, what would happen if...Ch. 16 - Mutations are often considered harmful. Give an...Ch. 16 - Mistakes made during transcription affect the cell...Ch. 16 - Suppose that transduction took place when a U-tube...Ch. 16 - Suppose that you carried out a U-tube experiment...Ch. 16 - Prob. 5CHICh. 16 - Studies of phage therapy to treat bacterial...Ch. 16 - Enterococcus faecalis is a major cause of...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Surgical Tech For Surgical Tech Pos CareHealth & NutritionISBN:9781337648868Author:AssociationPublisher:Cengage
Principles Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Surgical Tech For Surgical Tech Pos Care
Health & Nutrition
ISBN:9781337648868
Author:Association
Publisher:Cengage
Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license