The function of squalene epoxidase, and why it is effective to target for selective toxicity to the fungus and not to the host. Concept introduction Different antimicrobial drugs are effective against a wide variety of microbes like there are antifungal, antibacterial, antiviral and anti-protozoan drugs. These drugs inhibit microbes either by affecting their metabolism , causing damage to their cell membrane, inhibiting their nucleic acid synthesis, disruption of cell membranes and by inhibiting protein synthesis. The drugs that belong to the benzimidazole family have therapeutic use as an antifungal. These drugs are responsible for inhibiting microtubule synthesis and glucose uptake in fungal cells.

Question

Want to see the full answer?

Answer 1

Question

Chapter 16, Problem 9Q

Summary Introduction

To determine:

The function of squalene epoxidase, and why it is effective to target for selective toxicity to the fungus and not to the host.

Concept introduction

Different antimicrobial drugs are effective against a wide variety of microbes like there are antifungal, antibacterial, antiviral and anti-protozoan drugs. These drugs inhibit microbes either by affecting their metabolism, causing damage to their cell membrane, inhibiting their nucleic acid synthesis, disruption of cell membranes and by inhibiting protein synthesis. The drugs that belong to the benzimidazole family have therapeutic use as an antifungal. These drugs are responsible for inhibiting microtubule synthesis and glucose uptake in fungal cells.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks

Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?

What is amplification bias?

Answer 2

Question

Chapter 16, Problem 9Q

Summary Introduction

To determine:

The function of squalene epoxidase, and why it is effective to target for selective toxicity to the fungus and not to the host.

Concept introduction

Different antimicrobial drugs are effective against a wide variety of microbes like there are antifungal, antibacterial, antiviral and anti-protozoan drugs. These drugs inhibit microbes either by affecting their metabolism, causing damage to their cell membrane, inhibiting their nucleic acid synthesis, disruption of cell membranes and by inhibiting protein synthesis. The drugs that belong to the benzimidazole family have therapeutic use as an antifungal. These drugs are responsible for inhibiting microtubule synthesis and glucose uptake in fungal cells.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 3

Question

Chapter 16, Problem 9Q

Summary Introduction

To determine:

The function of squalene epoxidase, and why it is effective to target for selective toxicity to the fungus and not to the host.

Concept introduction

Different antimicrobial drugs are effective against a wide variety of microbes like there are antifungal, antibacterial, antiviral and anti-protozoan drugs. These drugs inhibit microbes either by affecting their metabolism, causing damage to their cell membrane, inhibiting their nucleic acid synthesis, disruption of cell membranes and by inhibiting protein synthesis. The drugs that belong to the benzimidazole family have therapeutic use as an antifungal. These drugs are responsible for inhibiting microtubule synthesis and glucose uptake in fungal cells.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 4

Question

Chapter 16, Problem 9Q

Summary Introduction

To determine:

The function of squalene epoxidase, and why it is effective to target for selective toxicity to the fungus and not to the host.

Concept introduction

Different antimicrobial drugs are effective against a wide variety of microbes like there are antifungal, antibacterial, antiviral and anti-protozoan drugs. These drugs inhibit microbes either by affecting their metabolism, causing damage to their cell membrane, inhibiting their nucleic acid synthesis, disruption of cell membranes and by inhibiting protein synthesis. The drugs that belong to the benzimidazole family have therapeutic use as an antifungal. These drugs are responsible for inhibiting microtubule synthesis and glucose uptake in fungal cells.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 5

Chapter 16, Problem 9Q

Summary Introduction

To determine:

The function of squalene epoxidase, and why it is effective to target for selective toxicity to the fungus and not to the host.

Concept introduction

Different antimicrobial drugs are effective against a wide variety of microbes like there are antifungal, antibacterial, antiviral and anti-protozoan drugs. These drugs inhibit microbes either by affecting their metabolism, causing damage to their cell membrane, inhibiting their nucleic acid synthesis, disruption of cell membranes and by inhibiting protein synthesis. The drugs that belong to the benzimidazole family have therapeutic use as an antifungal. These drugs are responsible for inhibiting microtubule synthesis and glucose uptake in fungal cells.

Answer 6

Chapter 16, Problem 9Q

Summary Introduction

To determine:

The function of squalene epoxidase, and why it is effective to target for selective toxicity to the fungus and not to the host.

Concept introduction

Different antimicrobial drugs are effective against a wide variety of microbes like there are antifungal, antibacterial, antiviral and anti-protozoan drugs. These drugs inhibit microbes either by affecting their metabolism, causing damage to their cell membrane, inhibiting their nucleic acid synthesis, disruption of cell membranes and by inhibiting protein synthesis. The drugs that belong to the benzimidazole family have therapeutic use as an antifungal. These drugs are responsible for inhibiting microtubule synthesis and glucose uptake in fungal cells.

Answer 7

Chapter 16, Problem 9Q

Summary Introduction

To determine:

The function of squalene epoxidase, and why it is effective to target for selective toxicity to the fungus and not to the host.

Concept introduction

Different antimicrobial drugs are effective against a wide variety of microbes like there are antifungal, antibacterial, antiviral and anti-protozoan drugs. These drugs inhibit microbes either by affecting their metabolism, causing damage to their cell membrane, inhibiting their nucleic acid synthesis, disruption of cell membranes and by inhibiting protein synthesis. The drugs that belong to the benzimidazole family have therapeutic use as an antifungal. These drugs are responsible for inhibiting microtubule synthesis and glucose uptake in fungal cells.

Answer 8

Expert Solution & Answer

Answer 9

Expert Solution & Answer

Answer 10

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 11

Ch. 16.1 - Describe the important anatomical features of the...Ch. 16.1 - Prob. 2AYP Ch. 16.1 - Prob. 1NP Ch. 16.2 - Prob. 3AYP Ch. 16.3 - Prob. 4AYP Ch. 16.3 - Prob. 5AYP Ch. 16.3 - Prob. 6AYP Ch. 16.3 - Prob. 7AYP Ch. 16.3 - Prob. 2NP Ch. 16.3 - Prob. 3NP

Solution Summary: The author explains the function of squalene epoxidase and why it is effective to target for selective toxicity to the fungus and not the host.

Videos

Want to see the full answer?

Chapter 16 Solutions