DNA strands are antiparallel and during DNA replication , the two new strands formed are also antiparallel to the template parent strand. DNA polymerase enzyme can only add nucleotides to the 3′ end. Hence, the synthesis is continuous in one strand toward the fork in the 5′-3′ direction. It is known as the leading strand.

Question

Want to see the full answer?

Answer 1

Question

Chapter 16, Problem 4TYU

Summary Introduction

Introduction: DNA strands are antiparallel and during DNA replication, the two new strands formed are also antiparallel to the template parent strand. DNA polymerase enzyme can only add nucleotides to the 3′ end. Hence, the synthesis is continuous in one strand toward the fork in the 5′-3′ direction. It is known as the leading strand.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks

Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?

What is amplification bias?

Answer 2

Question

Chapter 16, Problem 4TYU

Summary Introduction

Introduction: DNA strands are antiparallel and during DNA replication, the two new strands formed are also antiparallel to the template parent strand. DNA polymerase enzyme can only add nucleotides to the 3′ end. Hence, the synthesis is continuous in one strand toward the fork in the 5′-3′ direction. It is known as the leading strand.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 3

Question

Chapter 16, Problem 4TYU

Summary Introduction

Introduction: DNA strands are antiparallel and during DNA replication, the two new strands formed are also antiparallel to the template parent strand. DNA polymerase enzyme can only add nucleotides to the 3′ end. Hence, the synthesis is continuous in one strand toward the fork in the 5′-3′ direction. It is known as the leading strand.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 4

Question

Chapter 16, Problem 4TYU

Summary Introduction

Introduction: DNA strands are antiparallel and during DNA replication, the two new strands formed are also antiparallel to the template parent strand. DNA polymerase enzyme can only add nucleotides to the 3′ end. Hence, the synthesis is continuous in one strand toward the fork in the 5′-3′ direction. It is known as the leading strand.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 5

Chapter 16, Problem 4TYU

Summary Introduction

Introduction: DNA strands are antiparallel and during DNA replication, the two new strands formed are also antiparallel to the template parent strand. DNA polymerase enzyme can only add nucleotides to the 3′ end. Hence, the synthesis is continuous in one strand toward the fork in the 5′-3′ direction. It is known as the leading strand.

Answer 6

Chapter 16, Problem 4TYU

Summary Introduction

Introduction: DNA strands are antiparallel and during DNA replication, the two new strands formed are also antiparallel to the template parent strand. DNA polymerase enzyme can only add nucleotides to the 3′ end. Hence, the synthesis is continuous in one strand toward the fork in the 5′-3′ direction. It is known as the leading strand.

Answer 7

Chapter 16, Problem 4TYU

Summary Introduction

Introduction: DNA strands are antiparallel and during DNA replication, the two new strands formed are also antiparallel to the template parent strand. DNA polymerase enzyme can only add nucleotides to the 3′ end. Hence, the synthesis is continuous in one strand toward the fork in the 5′-3′ direction. It is known as the leading strand.

Answer 8

Expert Solution & Answer

Answer 9

Expert Solution & Answer

Answer 10

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 11

Ch. 16.1 - Given a polynucleotide sequence such as GAATTC,...Ch. 16.1 - VISUAL SKILLS Griffith was trying to develop a...Ch. 16.2 - What role does complementary base pairing play in...Ch. 16.2 - Identify two major functions of DNA pol III in DNA...Ch. 16.2 - Prob. 3CC Ch. 16.2 - Prob. 4CC Ch. 16.3 - Describe the structure of a nucleosome, the basic...Ch. 16.3 - What two properties, one structural and one...Ch. 16.3 - MAKE CONNECTIONS Interphase chromosomes appear to...Ch. 16 - What does it mean wheti we say that the two DNA...

Want to see the full answer?

Chapter 16 Solutions