GENETICS:FROM GENES TO GENOMES(LL)-PKG
6th Edition
ISBN: 9781260377033
Author: HARTWELL
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 16, Problem 27P
The following is a sequence of the leader region of the his operon mRNA in Salmonella typhimurium. What bases in this sequence could cause a ribosome to pause when histidine is limiting (that is, when there is very little of it) in the medium?
5′AUGACACGCGUUCAAUUUAAACACCACCAUCAUCACCAUCA UCCUGACUAGUCUUUCAGGC3′
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
A sample of blood was taken from the above individual and prepared for haemoglobin analysis. However, when water was added the cells did not lyse and looked normal in size and shape. The technician suspected that they had may have made an error in the protocol – what is the most likely explanation?
The cell membranes are more resistant than normal.
An isotonic solution had been added instead of water.
A solution of 0.1 M NaCl had been added instead of water.
Not enough water had been added to the red blood cell pellet.
The man had sickle-cell anaemia.
A sample of blood was taken from the above individual and prepared for haemoglobin analysis. However, when water was added the cells did not lyse and looked normal in size and shape. The technician suspected that they had may have made an error in the protocol – what is the most likely explanation?
The cell membranes are more resistant than normal.
An isotonic solution had been added instead of water.
A solution of 0.1 M NaCl had been added instead of water.
Not enough water had been added to the red blood cell pellet.
The man had sickle-cell anaemia.
With reference to their absorption spectra of the oxy haemoglobin intact line) and deoxyhemoglobin (broken line) shown in Figure 2 below, how would you best explain the reason why there are differences in the major peaks of the spectra? Figure 2. SPECTRA OF OXYGENATED AND DEOXYGENATED HAEMOGLOBIN OBTAINED WITH THE RECORDING SPECTROPHOTOMETER 1.4 Abs < 0.8 06 0.4 400 420 440 460 480 500 520 540 560 580 600 nm 1. The difference in the spectra is due to a pH change in the deoxy-haemoglobin due to uptake of CO2- 2. There is more oxygen-carrying plasma in the oxy-haemoglobin sample. 3. The change in Mr due to oxygen binding causes the oxy haemoglobin to have a higher absorbance peak. 4. Oxy-haemoglobin is contaminated by carbaminohemoglobin, and therefore has a higher absorbance peak 5. Oxy-haemoglobin absorbs more light of blue wavelengths and less of red wavelengths than deoxy-haemoglobin
Chapter 16 Solutions
GENETICS:FROM GENES TO GENOMES(LL)-PKG
Ch. 16 - For each of the terms in the left column, choose...Ch. 16 - The following statement occurs early in this...Ch. 16 - One of the main lessons of this chapter is that...Ch. 16 - All mutations that abolish function of the Rho...Ch. 16 - The figure at the beginning of this chapter shows...Ch. 16 - The promoter of an operon is the site to which RNA...Ch. 16 - You are studying an operon containing three genes...Ch. 16 - You have isolated a protein that binds to DNA in...Ch. 16 - You have isolated two different mutants reg1 and...Ch. 16 - Bacteriophage , after infecting a cell, can...
Ch. 16 - Mutants were isolated in which the constitutive...Ch. 16 - Suppose you have six strains of E. coli. One is...Ch. 16 - The previous problem raises some interesting...Ch. 16 - For each of the E. coli strains containing the lac...Ch. 16 - For each of the following growth conditions, what...Ch. 16 - For each of the following mutant E. coli strains,...Ch. 16 - Maltose utilization in E. coli requires the...Ch. 16 - Seven E. coli mutants were isolated. The activity...Ch. 16 - Cells containing missense mutations in the crp...Ch. 16 - Six strains of E.coli mutants 16 that had one of...Ch. 16 - a. The original constitutive operator mutations in...Ch. 16 - In an effort to determine the location of an...Ch. 16 - Prob. 23PCh. 16 - The footprinting experiment described in Fig....Ch. 16 - Why is the trp attenuation mechanism unique to...Ch. 16 - a. How many ribosomes are required at a minimum...Ch. 16 - The following is a sequence of the leader region...Ch. 16 - For each of the E. coli strains that follow,...Ch. 16 - Prob. 29PCh. 16 - For each element in the list that follows,...Ch. 16 - Among the structurally simplest riboswitches are...Ch. 16 - Great variation exists in the mechanisms by which...Ch. 16 - Many genes whose expression is turned on by DNA...Ch. 16 - In 2005, Frederick Blattner and his colleagues...Ch. 16 - The E.coli MalT protein is a positive regulator of...Ch. 16 - Prob. 36PCh. 16 - Prob. 37PCh. 16 - Prob. 38PCh. 16 - Prob. 39PCh. 16 - Prob. 40PCh. 16 - Prob. 41PCh. 16 - The researchers who investigated bioluminescence...Ch. 16 - Prob. 43PCh. 16 - Quorum sensing controls the expression of...Ch. 16 - Scientists are currently screening a chemical...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- With reference to their absorption spectra of the oxy haemoglobin intact line) and deoxyhemoglobin (broken line) shown in Figure 2 below, how would you best explain the reason why there are differences in the major peaks of the spectra? Figure 2. SPECTRA OF OXYGENATED AND DEOXYGENATED HAEMOGLOBIN OBTAINED WITH THE RECORDING SPECTROPHOTOMETER 1.4 Abs < 0.8 06 0.4 400 420 440 460 480 500 520 540 560 580 600 nm 1. The difference in the spectra is due to a pH change in the deoxy-haemoglobin due to uptake of CO2- 2. There is more oxygen-carrying plasma in the oxy-haemoglobin sample. 3. The change in Mr due to oxygen binding causes the oxy haemoglobin to have a higher absorbance peak. 4. Oxy-haemoglobin is contaminated by carbaminohemoglobin, and therefore has a higher absorbance peak 5. Oxy-haemoglobin absorbs more light of blue wavelengths and less of red wavelengths than deoxy-haemoglobinarrow_forwardWhich ONE of the following is FALSE regarding haemoglobin? It has two alpha subunits and two beta subunits. The subunits are joined by disulphide bonds. Each subunit covalently binds a haem group. Conformational change in one subunit can be transmitted to another. There are many variant ("mutant") forms of haemoglobin that are not harmful.arrow_forwardWhich ONE of the following is FALSE regarding haemoglobin? It has two alpha subunits and two beta subunits. The subunits are joined by disulphide bonds. Each subunit covalently binds a haem group. Conformational change in one subunit can be transmitted to another. There are many variant ("mutant") forms of haemoglobin that are not harmful.arrow_forward
- During a routine medical check up of a healthy man it was found that his haematocrit value was highly unusual – value of 60%. What one of the options below is the most likely reason? He will have a diet high in iron. He is likely to be suffering from anaemia. He lives at high altitude. He has recently recovered from an accident where he lost a lot of blood. He has a very large body size.arrow_forwardExplain what age of culture is most likely to produce an endospore?arrow_forwardExplain why hot temperatures greater than 45 degrees celsius would not initiate the sporulation process in endospores?arrow_forward
- Endospore stain: Consider tube 2 of the 7-day bacillus culture. After is was heated, it was incubated for 24 hours then refrigerated. Do you think the cloudiness in this tube is due mostly to vegetative cells or to endospores? Explain your reasoningarrow_forwardReactunts C6H12O6 (Glucose) + 2NAD+ + 2ADP 2 Pyruvic acid + 2NADH + 2ATP a. Which of the above are the reactants? b. Which of the above are the products? c. Which reactant is the electron donor? GHz 06 (glucose) d. Which reactant is the electron acceptor? NAD e. Which of the products have been reduced? NADH f. Which of the products have been oxidized? g. Which process was used to produce the ATP? h. Where was the energy initially in this chemical reaction and where is it now that it is finished? i. Where was the carbon initially in this chemical reaction and where is it now that it is finished? j. Where were the electrons initially in this chemical reaction and where is it now that it is finished? 3arrow_forwardThere is ________ the concept of global warming. Very strong evidence to support Some strong evidence to support Evidence both supporting and against Evidence againstarrow_forward
- How many types of reactions can an enzyme perform?arrow_forwardYour goal is to produce black seeds resistant to mold. So you make the same cross again (between a homozygous black seeded, mold susceptible parent and a homozygous white seeded and mold resistant parent), and, again, advance progeny by SSD to create 100 F10 generation plants. Based on the information you obtained from your first crossing experiment (Question #4), how many F10 plants would you expect to have black seeds and be resistant to mold? Assume that a toxin produced by the mold fungus has been isolated. Only mold resistant seeds will germinate in the presence of the toxin. Could you use this toxin screening procedure to have segregation distortion work in your favor in the F2 generation? Explain your answer. Info from Question 4 a. P Locus (Seed Color): Hypothesis: The null hypothesis (H₀) is that seed color is controlled by alleles at a single locus. Observed Data: Total white seeds: 45 (resistant plants) + 6 (susceptible plants) = 51 Total black seeds: 7 (resistant…arrow_forward10. Consider the following enzyme and its substrate where the "+" and "-" indicate cations and anions, respectively. Explain which of the following inhibitors could inhibit this enzyme? Which type of inhibitor would it be and why? (Video 5-2) Substrate Enzyme Potential inhibitorsarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license