Concept explainers
Videos
What does it mean wheti we say that the two DNA strands in the double helix are antiparallel? What would an end of the double helix look like if the strands were parallel?
To explain: The meaning of the statement “the two strands in the double helix DNA are antiparallel”.
Introduction: DNA is a double-stranded molecule that consists of two strands of nucleotides. The bases in one strand are complementary to the bases on the other strand. During DNA replication, the two strands of parent DNA molecule separate. The parent strands act as templates along which the DNA polymerases add up the complementary base pairs in the context of base-pairing rules.
Explanation of Solution
A deoxyribonucleic acid (DNA) molecule consists of two polynucleotide chains that associate as a double helix structure. The polarity in the DNA chain is referred to as 5ʹ end and the other as 3ʹ end. One end of DNA consists of a phosphate attached to a 5ʹ deoxyribose carbon (5ʹ end), and the other end has a hydroxyl group that is attached to a 3ʹ deoxyribose carbon (3ʹ end). The nucleotides are linked by phosphodiester bonds through 5ʹ-P of one sugar and 3ʹ-OH group of the next sugar. In a double-stranded DNA, one strand is “complemented” by the other strand. If one DNA strand runs in the 5ʹ→3ʹ direction, its complementary strand would run in the 3ʹ→5ʹ direction. Thus, the two strands are antiparallel to each other.
To determine: The ends of a double helix DNA if the two DNA strands in the double helix were parallel.
Introduction: DNA or deoxyribonucleic acid carries hereditary information from one generation to another. DNA replication is a process that takes place in every biological cell. It involves the coping and producing of two identical copies of a cell from their parent DNA molecule.
Explanation of Solution
If two DNA strands run in parallel directions, they would run in the same direction, that is, they would both run in the 5′→3′ direction. In such a condition, in the same side, an end of the DNA molecule would have two 5′ ends and two 3′ ends.
Want to see more full solutions like this?
Chapter 16 Solutions
Campbell Biology, Books a la Carte Plus Mastering Biology with eText -- Access Card Package (10th Edition)
Additional Science Textbook Solutions
LooseLeaf for Integrated Principles of Zoology
Campbell Biology: Concepts & Connections (9th Edition)
Biology: Concepts and Investigations
Human Anatomy & Physiology
- Write the sequence of the complementary DNA strand thatpairs with each of the following DNA base sequences:(a) GGTTAC(b) CCCGAAarrow_forwardGiven a sequence of a DNA coding strand: 5’-ATGATTATCCTATAG-3’ What is the sequence and direction of the complementary DNA strand?arrow_forwardFor the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strandarrow_forward
- If the sequence of one strand of a DNA molecule is 5’-AGCCCCGACTCTATTC-3’, what is the sequence of the complementary strand?arrow_forwardWhich of the following pieces of DNA is going to be easier to separate into single stranded molecules using heat (ie, have a lower melting point), which breaks hydrogen bonds? Why? 1. 5’ ATTTTCCGTAAT 3’ 3’ TAAAAGGCATTA 5’ 2. 5’ ACGGTTTACCGG 3’ 3’ TGCCAAATGGCC 5’ A) 2; it has more C-G pairs which are connected by three hydrogen bonds instead of two, so they are easier to break. B) 1; it has more A-T pairs which are connected by one hydrogen bond instead of two, so they are easier to break. C) 2; it has more C-G pairs which are connected by two hydrogen bonds instead of three, so they are easier to break. D)1; it has more A-T pairs which are connected by two hydrogen bonds instead of three, so they are easier to break.arrow_forwardIf one side of the helix is CACTGGACTGTG, the complementary side would be??arrow_forward
- What are the base-pairing rules for DNA? a. A-G, T-C c. A-T, G-C b. A-C, T-G d. A-A, G-G, C-C, T-Tarrow_forwardGive the base sequence of the complementary DNA strand of the DNA chain with the following base sequence: 5’ ACGTAG 3’arrow_forwardOne DNA chain of a DNA double helix contains 18% A, 35% T, 28% C, and 21% G. What is the composition of the complementary DNA chain?arrow_forward
- Which strand below would be the complementary strand for the sequence AAACGCTT O GGGTATCC O AAGCGTTT O TTTGCGAA O AAACGCTT Next»arrow_forwardHere is a DNA coding strand’s sequence and direction: 5’-ATGCCGATATAG-3’ . What would be the amino acid sequence in the polypeptide encoded by this DNA?arrow_forwardOne strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base sequence of the complementary strand. 5'- What special type of sequence is contained in this DNA segment? Hoogsteen pairing major groove O palindrome mirror repeat What alternative structure does the double-stranded DNA have the potential to form? B-DNA O a G tetraplex triplex DNA a cruciform Z-form DNAarrow_forward
