CONNECT WITH LEARNSMART FOR COWAN: MICR
3rd Edition
ISBN: 2818440123740
Author: Cowan
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Question
Chapter 15.5, Problem 3MM
Summary Introduction
To determine:
The consequences of taking several weeks to confirm a TB diagnosis, as opposed to 90 minutes.
Concept introduction:
The bacterium Mycobacterium tuberculosis causes tuberculosis and lungs are primarily infected by this bacterium. The TB bacteria can invade the other parts of the body apart from lungs, such as spine and the kidney. Not every person exposed to TB bacteria gets sick. There are two major medical conditions associated with TB bacteria, TB disease and latent TB infection.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 15 Solutions
CONNECT WITH LEARNSMART FOR COWAN: MICR
Ch. 15.1 - Prob. 1AYPCh. 15.1 - Provide a one-sentence description for each of...Ch. 15.2 - Identify factors that may affect the...Ch. 15.2 - Prob. 4AYPCh. 15.2 - NCLEX PREX 1. An RN is training a new staff nurse...Ch. 15.2 - NCLEX PREX 2. A clinical form used to report data...Ch. 15.3 - List at least three different tests that fall in...Ch. 15.3 - Prob. 6AYPCh. 15.3 - Discuss two major drawbacks of phenotypic testing...Ch. 15.3 - Q. What technique in this chapter do most home...
Ch. 15.3 - NCLEX PREX 3. When determining the clinical...Ch. 15.4 - Define the term serology, and explain the...Ch. 15.4 - Identify two immunological diagnostic techniques...Ch. 15.4 - Prob. 2MMCh. 15.5 - Explain why PCR is useful for infectious disease...Ch. 15.5 - Name two examples of techniques that employ...Ch. 15.5 - Explain how whole-genome sequencing can be used...Ch. 15.5 - Prob. 13AYPCh. 15.5 - Prob. 3MMCh. 15.6 - Describe the benefits of lab on a chip...Ch. 15.6 - Prob. 15AYPCh. 15 - When using pulsed-field gel electrophoresis,...Ch. 15 - Explain why it is possible to identify some...Ch. 15 - Serotyping identifies distinct members of the same...Ch. 15 - Prob. 4QCh. 15 - Name some bacterial structures that might be...Ch. 15 - You perform a lumbar puncture on a patient with...Ch. 15 - Which category of diagnosis is represented by...Ch. 15 - Write a paragraph that explains the mycobacterial...Ch. 15 - You inoculated a biochemical test strip with a...Ch. 15 - Prob. 10QCh. 15 - You perform a Kirby-Bauer disk diffusion test to...Ch. 15 - Why might culture conditions affect the results of...Ch. 15 - Which of the following techniques is most likely...Ch. 15 - Why is it more important to use selective media...Ch. 15 - What type of diagnostic method do you think would...Ch. 15 - T or F: Bacterial infection causes the expression...Ch. 15 - Prob. 17QCh. 15 - Prob. 18QCh. 15 - Prob. 19QCh. 15 - When PCR is performed by hand (not with a...Ch. 15 - What kind of a control would be important to run...
Knowledge Booster
Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Case Studies In Health Information ManagementBiologyISBN:9781337676908Author:SCHNERINGPublisher:CengageSurgical Tech For Surgical Tech Pos CareHealth & NutritionISBN:9781337648868Author:AssociationPublisher:Cengage
- Health Safety And Nutrition F/Young ChildHealth & NutritionISBN:9781305144767Author:MAROTZPublisher:CengageIssues and Ethics in the Helping Professions (Min...NursingISBN:9781337406291Author:Gerald Corey, Marianne Schneider Corey, Cindy CoreyPublisher:Cengage Learning
Case Studies In Health Information Management
Biology
ISBN:9781337676908
Author:SCHNERING
Publisher:Cengage
Surgical Tech For Surgical Tech Pos Care
Health & Nutrition
ISBN:9781337648868
Author:Association
Publisher:Cengage
Health Safety And Nutrition F/Young Child
Health & Nutrition
ISBN:9781305144767
Author:MAROTZ
Publisher:Cengage

Issues and Ethics in the Helping Professions (Min...
Nursing
ISBN:9781337406291
Author:Gerald Corey, Marianne Schneider Corey, Cindy Corey
Publisher:Cengage Learning