CAMPBELL BIOLOGY IN FOCUS-TEXT,AP ED.
3rd Edition
ISBN: 9780136811206
Author: Urry
Publisher: SAVVAS L
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 15, Problem 9TYU
FOCUS ON EVOLUTION
DNA sequences can act as “tape measures of evolution” (see Concept 3. 7).evolution.” Some highly conserved regions of the human genome (similar to comparable regions in other species) don't code for proteins. Propose a possible explanation
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Junk DNA — Not So Useless After All
https://healthland.time.com/2012/09/06/junk-dna-not-so-useless-after-all/
(Claim) Summarize scientist's error in naming noncoding DNA "junk" DNA. (Evidence) Is the amount of DNA an organism has correlated to intelligence or complexity? (Reasoning) What are two discovered uses of noncoding DNA (introns)?
Human Genome ProjectIn 2003, the Human Genome Project was successfully completed, determining the exact sequence of the entire human genome, which is made up of 3 billion nucleotide base pairs. The data generated from the Human Genome Project is freely available online to anyone. Many researches and innovations stemmed from the HGP, allowing the identifications of 1 800 disease genes. Many of the corporations using the results from the HGP are privately funded, and research is being done for profit even though the HGP results are provided freely.Identify one advantage and one disadvantage of corporate funding and patenting genetic research results.
Human Genome ProjectIn 2003, the Human Genome Project was successfully completed, determining the exact sequence of the entire human genome, which is made up of 3 billion nucleotide base pairs. The data generated from the Human Genome Project is freely available online to anyone. Many pieces of research and innovations stemmed from the HGP, allowing the identifications of 1 800 disease genes. Many of the corporations using the results from the HGP are privately funded, and research is being done for profit even though the HGP results are provided freely.
Identify one advantage and one disadvantage of corporate funding and patenting genetic research results.
Chapter 15 Solutions
CAMPBELL BIOLOGY IN FOCUS-TEXT,AP ED.
Ch. 15.1 - How does binding of the trp corepressor to its...Ch. 15.1 - Describe the binding of RNA polymerase,...Ch. 15.1 - WHAT IF? A certain mutation in E. coli changes the...Ch. 15.2 - Prob. 1CCCh. 15.2 - Compare the roles of general and specific...Ch. 15.2 - Prob. 3CCCh. 15.3 - WHAT IF? Suppose the mRNA being degraded in Figure...Ch. 15.3 - MAKE CONNECTIONS Inactivation of one of the X...Ch. 15.4 - Prob. 1CCCh. 15.4 - WHAT IF? Study the microarray in Figure 15.17. If...
Ch. 15 - If a particular operon encodes enzymes for making...Ch. 15 - The functioning of enhancers is an example of A. a...Ch. 15 - Which of the following is an example of...Ch. 15 - Prob. 4TYUCh. 15 - Prob. 5TYUCh. 15 - Which of the following would not be true of cDNA...Ch. 15 - Prob. 7TYUCh. 15 - SCIENTIFIC INQUIRY Imagine you want to study one...Ch. 15 - FOCUS ON EVOLUTION DNA sequences can act as tape...Ch. 15 - FOCUS ON INTERACTIONS In a short essay (100150...Ch. 15 - Prob. 11TYU
Additional Science Textbook Solutions
Find more solutions based on key concepts
A student moving out of a dormitory crouches in correct fashion to lift a heavy box of books. What prime movers...
HUMAN ANATOMY
More than one choice may apply. Using the terms listed below, fill in the blank with the proper term. anterior ...
Essentials of Human Anatomy & Physiology (12th Edition)
2. A gene is a segment of DNA that has the information to produce a functional product. The functional product ...
Genetics: Analysis and Principles
Why is it necessary to be in a pressurized cabin when flying at 30,000 feet?
Anatomy & Physiology (6th Edition)
The term ‘spore’.
Biology Science Notebook
Some people consider Pasteur or Koch to be the Father of Microbiology, rather than Leeuwenhoek. Why might they ...
Microbiology with Diseases by Body System (4th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- 3arrow_forwardSignal Village National High Learning Activity Sheet Heredity: Inheritance and Variation Science 10 Third Quarter-Week 4 ALME N Grade and Section Name of Student Name of Teacher Let's Explore This module we will be discussing about the DNA and mRNA and its role in performing a very important task of transferring codes to proteins that will be manifested in the body. But first, let's have this quick activity to get to know DNA ad mRNA well. LET US PAIR! The sequence of bases in one DNA / RNA (indicated per item) strand is given below. Identify the complementary sequence of bases in the other strand of DNA/RNA. The first one is done for you. DNA RNA A always pairs with T A always pairs with U C aiwayspairs with G C always p airs with G DNA: 1. DNA: 2. RNA: G. 3. DNA: A 4. RNA: G. G. SIGNALarrow_forward3. Analyzing the Molecules of Life - Molecular Diagnostics An mRNA that encodes a variant of a human protein is as follows (the mutation is highlighted in red): CUUGUUAACAACUAAACGAACAAUCUUUGUUUUUCUUGUUUUAUUGCCACUAGUCUCUAG UCAGUGUGUUAAUCUUACAACCAGAACUCAAUUACCCCCUGCAUACACUAAUUCUUUCAC ACGUGGUGUUUAUUACCCUGACAAAGUUUUCAGAUCCUCAGUUUUACAUUCAACUCAGGA CUUGUUCUUACCUUUCUUUUCCAAUGUUACUUGGUUCCAUGCUAUACAUGUCUCUGGUAA RT-qPCR can be used to detect the variant (mutation). (a) In a few sentences or using a simple diagram/flowchart, describe the basic principle of RT-qPCR, and show the sequence of a DNA primer that can be used to reverse transcribe the entire RNA molecule as shown at 37 °C. (b) Design a pair of primers (DNA oligonucleotides) for detecting the mutation by qPCR. Assume that the PCR reaction will be performed at 72 °C. Show the sequences of your primers and their estimated Tm.arrow_forward
- Molecular Biology (Biol-L211) Dr. Nole Central Dogma Practice - Processes The general flow of genetic information is diagrammed below. Think carefully about what type of molecule is represented by each item in the diagram and clearly address each of the following. A. Label each structure as mature mRNA, pre-mRNA, protein, or DNA. B. Label each arrow to indicate which is processing, transcription, replication, and translation. C. Identify the general location (on the appropriate molecule) of the promoter sequence and the terminator sequence. D. Identify the specific location of the place where the start codon and stop codon function most directly. E. Where does RNA polymerase bind to begin transcription? F. Where specifically does the ribosome bind to begin translation-i.e., what are the ribosome binding sites and where are they found? G. Label each end of the mature mRNA and the polypeptide to correctly specify polarity. (You should use the labels 3', 5', C-terminus, and N-terminus.)arrow_forwardMolecular Biology (Biol-L211) Dr. Nole Central Dogma Practice - Processes The general flow of genetic information is diagrammed below. Think carefully about what type of molecule is represented by each item in the diagram and clearly address each of the following. A. Label each structure as mature mRNA, pre-mRNA, protein, or DNA. B. Label each arrow to indicate which is processing, transcription, replication, and translation. C. Identify the general location (on the appropriate molecule) of the promoter sequence and the terminator sequence. D. Identify the specific location of the place where the start codon and stop codon function most directly (i.e., which molecule is actually translated?). E. Where does RNA polymerase bind to begin transcription? F. Where specifically does the ribosome bind to begin translation-i.e., what are the ribosome binding sites (in both prokaryotes and eukaryotes) and where are they found? G. Label each end of the mature mRNA and the polypeptide to correctly…arrow_forwardGive typing answer with explanation and conclusionarrow_forward
- I wanted to know where in the concepts of genetics 12th edition book can I find the answer to my question? What are the key properties of the genetic code? Given that the genomes of all organisms are made up of As, Ts, Cs, and Gs, how does one account for diversity in organisms? What are some factors that could adversely affect diversity in nature?arrow_forward???arrow_forwardRead This! Extensive research has been done to find similarities and differences in the DNA sequences of different an- imals. This work is very difficult and time consuming, but it can help biologists determine the evolution- ary ancestry of a species. For example, when investigating the human genome, biologists found that about 99.5% of the DNA sequences among humans are the same. Considering the wide variety of traits in the human population, we are a lot more similar than we are different. Humans share approximately 96% of their DNA sequences with chimpanzees, 85% with mice, and 75% with chickens. 16. Study the table below. Organism Pair Percentage of DNA Similarity A-B 97 A-C 85 A-D 50 a. To which organism, B, C or D, is organism A most closely related? Support your answer. b. Which pair of organisms in the table is least closely related? Support your answer. c. Which pair of organisms most likely shares a recent common ancestor? Support your answer. 4 POGIL™ Activities for High…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Mechanisms of Genetic Change or Evolution; Author: Scientist Cindy;https://www.youtube.com/watch?v=5FE8WvGzS4Q;License: Standard Youtube License