
Concept explainers
Introduction:
In 1831, HMS Beagle set sail from England for Maderia and then proceeded to South America. The main mission of the ship was to survey the coast of South America. Darwin’s roles on the ship were of a naturalist and companion to the captain. His main job was to collect biological and geological specimens during the ship’s travels.

Answer to Problem 4A
Correct answer :
The correct answer is option A. Earth and life are recent and have remained unchanged
Explanation of Solution
Explanation/justification for the correct answer:
Option A. Earth and life are recent and have remained unchanged −When Darwin took a voyage on the HMS Beaglein 1831 , people believed that earth was only 6000 years old. Almost everyone including young Darwin believed that plants and animals were unchanging.
Hence, this is the correct option.
Explanation for incorrect answer:
Option B. Species evolved rapidly during the first six thousand to a few hundred thousand years−When Darwin took a voyage on the HMS Beagle in 1831, people believed that earth was only 6000 years old. Almost everyone including young Darwin believed that plants and animals were unchanging. Hence, this is not the correct option.
Option C. Earth is billions of years old, but species have not evolved- When Darwin took a voyage on the HMS Beagle in 1831 , people believed that earth was only 6000 years old. Almost everyone including young Darwin believed that plants and animals were unchanging. Hence, this is not the correct option.
Option D. Species have evolved on earth for billions of years−When Darwin took a voyage on the HMS Beagle in 1831, people believed that earth was only 6000 years old. Almost everyone including young Darwin believed that plants and animals were unchanging. Hence this is not the correct option.
Chapter 15 Solutions
Biology Illinois Edition (Glencoe Science)
Additional Science Textbook Solutions
Cosmic Perspective Fundamentals
Chemistry: Structure and Properties (2nd Edition)
Campbell Essential Biology (7th Edition)
Microbiology: An Introduction
Microbiology with Diseases by Body System (5th Edition)
Anatomy & Physiology (6th Edition)
- Awnser these Discussion Questions Answer these discussion questions and submit them as part of your lab report. Part A: The Effect of Temperature on Enzyme Activity Graph the volume of oxygen produced against the temperature of the solution. How is the oxygen production in 30 seconds related to the rate of the reaction? At what temperature is the rate of reaction the highest? Lowest? Explain. Why might the enzyme activity decrease at very high temperatures? Why might a high fever be dangerous to humans? What is the optimal temperature for enzymes in the human body? Part B: The Effect of pH on Enzyme Activity Graph the volume of oxygen produced against the pH of the solution. At what pH is the rate of reaction the highest? Lowest? Explain. Why does changing the pH affect the enzyme activity? Research the enzyme catalase. What is its function in the human body? What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…arrow_forwardAnwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forward
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





