Biology: The Unity and Diversity of Life (MindTap Course List)
14th Edition
ISBN: 9781305073951
Author: Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 15, Problem 3DAA
Summary Introduction
To determine: The mice that learned faster in the second time test.
Concept introduction: Autism is a neurological disorder in which patients have impaired social interactions, repetitive and stereotyped behavior. The condition appears due to mutation in the gene neuroligin 3, an adhesion protein that connects brain cells together. The mutation causes substitution of a cysteine (C) residue by arginine (R) residue in position 451.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Kindly check if this is correct.
Homozygosity for extremely rare mutations in a humangene called SCN9A cause complete insensitivity topain (congenital pain insensitivity or CPA) and a totallack of the sense of smell (anosmia). The SCN9A geneencodes a sodium channel protein required for transmission of electrical signals from particular nerves inthe body to the brain. The failure to feel pain is a dangerous condition as people cannot sense injuries.The SCN9A gene has 26 exons and encodes a1977-amino acid polypeptide. Consanguineous matings in three different families have resulted in individuals with CPA/anosmia. In Family 1, a G-to-Atransition in exon 15 results in a truncated protein that is898 amino acids long; in Family 2, deletion of a singlebase results in a 766-amino acid polypeptide; and inFamily 3, a C-to-G transversion in exon 10 yields a458-amino acid protein.a. Hypothesize as to how each of the three SCN9Amutations affects gene structure: Why are truncatedproteins made in each case? b. How would you…
Provide the translation for each of the potential fathers
Chapter 15 Solutions
Biology: The Unity and Diversity of Life (MindTap Course List)
Ch. 15 - _________ cut(s) DNA molecules at specific sites....Ch. 15 - Prob. 2SQCh. 15 - Prob. 3SQCh. 15 - For each species, all ________ in the complete set...Ch. 15 - A set of cells that host various DNA fragments...Ch. 15 - Prob. 6SQCh. 15 - Prob. 7SQCh. 15 - PCR can be used _______. a. to increase the number...Ch. 15 - An individuals set of unique _______ can be used...Ch. 15 - A transgenic organism _______. a. carries a gene...
Ch. 15 - Enhanced Spatial Learning in Mice With an Autism...Ch. 15 - Enhanced Spatial Learning in Mice With an Autism...Ch. 15 - Prob. 3DAACh. 15 - Prob. 4DAACh. 15 - True or false? A transgenic organism can pass a...Ch. 15 - Which of the following can be used to carry...Ch. 15 - Prob. 13SQCh. 15 - Match the method with the appropriate enzyme....Ch. 15 - Match each term with the most suitable...Ch. 15 - Prob. 1CTCh. 15 - Prob. 2CT
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Enhanced Spatial Learning in Mice With an Autism Mutation Autism is a neurobiological disorder with symptoms that include impaired social interactions and stereotyped patterns of behavior. Around 10 percent of autistic people have an extraordinary skill or talent such as greatly enhanced memory. Mutations in neuroligin 3, an adhesion protein that connects brain cells to one another, have been associated with autism. One mutation changes amino acid 451 from arginine to cysteine. In 2007, Katsuhiko Tabuchi and his colleagues genetically modified mice to carry the same arginine-to-cysteine substitution in their neuroligin 3. Mice with the mutation had impaired social behavior. To test spatial learning ability, the mice were placed in a water maze: a deep pool of warm water in which a platform is submerged a few millimeters below the surface. The platform is not visible to swimming mice. Mice do not particularly enjoy swimming, so they locate a hidden platform as fast as they can. When tested again, they can remember its location by checking visual cues around the edge of the pool. How quickly they remember the platforms location is a measure of spatial learning ability (FIGURE 15.18). FIGURE 15.18 spatial learning ability in mica mutation in neuroligin 3 (R451C), compared with unmodified (wild-type) mica. 2. Did the modified or the unmodified mice learn the location of the platform faster in the first test?arrow_forwardTwo types of mutations discussed in this chapter are (1) nucleotide changes and (2) unstable genome regions that undergo dynamic changes. Describe each type of mutation.arrow_forwardEnhanced Spatial Learning Ability in Mice Engineered to Carry an Autism Mutation Autism is a neurobiological disorder with symptoms that include impaired social interactions and repetitive, stereotyped patterns of behavior. Around 10 percent of autistic people also have an extraordinary skill or talent such as greatly enhanced memory. Mutations in the gene for neuroligin 3, an adhesion protein that connects brain cells, have been associated with autism. One of these mutations is called R451C because the altered gene encodes a protein with an amino acid substitution: a cysteine (C) instead of an arginine (R) in position 451. In 2007, Katsuhiko Tabuchi and his colleagues introduced the R451C mutation into the neuroligin 3 gene of mice. The researchers discovered that the genetically modified mice had impaired social behavior and superior spatial learning ability. Spatial learning in mice is tested with a water maze, which consists of a small platform submerged a bit below the surface or a pool of water so it is invisible to a swimming mouse. Mice do not particularly enjoy swimming, so they try to locate the hidden platform as quickly as they can. When tested again later, they remember the platforms location by checking visual cues around the edge or the pool. How quickly they remember is a measure of their spatial learning ability. FIGURE 15.14 shows some or Tabuchis result. FIGURE 15.14 Spatial learning ability in mice. Mice with a mutation in neuroligin 3 (R451C) were tested for learning performance: as compared with unmodified (wild-type) mice. Did the modified or the unmodified mice learn the location of the platform faster in the first test?arrow_forward
- The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this protein have been recovered. Using the normal and mutant sequences, determine the DNA and mRNA sequences that code for this portion of the protein, and explain each of the mutations. a. met-trp- b. met-cys-ile-val-val-leu-gln- c. met-trp-tyr-arg-ser-pro-thr- d. met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-arrow_forwardCan someone explain explain how the silent and missense mutations are different from each other? I know leucine and valine aren’t stop codons, but why is one silent and the other a missense? Thanks for explainingarrow_forwardshort answer please! thank you!arrow_forward
- Please help me, this is from practice, double check your answers, previous tutors got it wrongarrow_forwardThe attached table below shows the reference and a diseased patient's DMD genes in the hip flexor which, if mutated, can cause muscular dystophy. Analyze the table, make the coding strand, and explain how and which mutation in the patien's genes caused muscular dystrophyarrow_forwardMatch the relationships to the corresponding concepts. Expanding nucleotide repeat..... Somatic mutation Base substitution Transition Missence mutation Nuetral mutation Mutation Germline mutation Transversion Silent mutation Indels Frameshift mutation Nonsense mutation Inherited change in DNA sequence Loss of function mutation Gain of function mutation Insertions Deletions Reading frame Answer Bank involving the number of repeat sequences often lead to if removes function alteration of single nucleotides are often alter the alters sense codon to stop codon substitution of unlike base alters the amino acid in protein insertions and deletions of sequences are based on type of tissue, can be does not alter function substitution of like base defined as does not alter amino acid in protein if gains functionarrow_forward
- THE MOLECULAR GENETICS OF SICKLE CELL ANEMIA The following is the base sequence of DNA that codes for first eight amino acids of the ß chain of hemoglobin. The ß chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. mone formed DNA Template Strand: 3'CACGTGGACTGAGGACTCCTC5' 1. What is the minimum number of DNA nucleotides in this whole gene? 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 4. What amino acids will this mRNA code for? 3. What mRNA will be formed from the template strand of DNA? 5. If the 17th base in the template strand of the DNA is changed from T to A, rewrite the new template strand below. 6. When the template strand of the DNA is changed, this is referred to as a mutation. What kind of mutation is this? 67arrow_forwardAnswer this pleasearrow_forwardA wildtype gene produces the polypeptide sequence: Wildtype: Met-Ser-Pro-Arg-Leu-Glu-Gly Each of the following polypeptide sequences is the result of a single mutation. Identify the most likely type of mutation causing each, be as specific as possible. M1:Met-Ser-Ser-Arg-Leu-Glu-Gly missense mutation M2:Met-Ser-Pro M3:Met-Ser-Pro-Asp-Trp-Arg-Asp-Lys M4:Met-Ser-Pro-Glu-Gly nonsense mutation frameshift insertion in frame deletion M5:Met-Ser-Pro-Arg-Leu-Glu-Gly in frame insertionarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781337408332Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781337408332
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Animal Communication | Ecology & Environment | Biology | FuseSchool; Author: FuseSchool - Global Education;https://www.youtube.com/watch?v=LsMbn3b1Bis;License: Standard Youtube License