Essentials of Genetics (9th Edition) - Standalone book
9th Edition
ISBN: 9780134047799
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 15, Problem 26PDQ
The interphase nucleus appears to be a highly structured organelle with chromosome territories, interchromosomal compartments, and transcription factories. In cultured human cells, researchers have identified approximately 8000 transcription factories per cell, each containing an average of eight tightly associated RNA polymerase II molecules actively transcribing RNA. If each RNA polymerase II molecule is transcribing a different gene, how might such a transcription factory appear? Provide a simple diagram that shows eight different genes being transcribed in a transcription factory and include the promoters, structural genes, and nascent transcripts in your presentation.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Using the transcription unit diagrammed below, in which exons are represented by blue boxes and introns are represented by the connecting lines.
You discover a single base deletion in region E of this DNA sequence. Regarding transcription, this mutation will likely:
1.) Result in an alteration to the mRNA sequence.
2.)Have no effect on transcription or the mRNA sequence
3.)Prevent transcription at the TATAA box
4.) Result in an increase or decrease in the amount of mRNA transcribed
The following double-stranded DNA sequence is part of a hypothetical yeast
genome which contains a very small gene. Transcription starts at the
Transcription Start Site (TSS), proceeds in the direction of the arrow and stops
at the end of the Transcription Terminator (green box).
5'
3'
TSS
CTATAAAAATGCCATGCATTATCTAGATAGTAGGCTCTGAGAAATTTATCTCACT
| | | | | | | | | |
GATATTTTTACGGTACGTAATAGATCTATCATCCGAGACTCTTTAAATAGAGTGA - 5'
PROMOTER
TERMINATOR
3'
a) Which strand (top or bottom) is the template strand? Explain why.
b) What is the sequence of the mRNA produced from this gene? Label the 5'
and 3' ends.
c) What is the sequence of the protein produced from the mRNA?
d) If a mutation (an insertion) were found where a T/A (top/bottom) base pair
were added immediately after the T/A base pair shown in red, what would be
the sequence of the mRNA? What would be the sequence of the protein?
Microbiologists describe the processes of transcription and translation as “coupled” in bacteria. This term indicates that bacterial mRNA can be undergoing transcription at the same moment it is also undergoing translation.
How is coupling possible in bacteria?
Is coupling of transcription and translation possible in single-celled eukaryotes, such as yeast? Why or why not?
Chapter 15 Solutions
Essentials of Genetics (9th Edition) - Standalone book
Ch. 15 -
CASE STUDY | A mysterious muscular dystrophy
A...Ch. 15 -
CASE STUDY |A mysterious muscular dystrophy
A...Ch. 15 -
CASE STUDY |A mysterious muscular dystrophy
A...Ch. 15 -
HOW DO WE KNOW?
1. In this chapter, we have...Ch. 15 -
2. Review the Chapter Concepts list on p. 280....Ch. 15 - Describe which enzymes are required for lactose...Ch. 15 - Contrast positive versus negative regulation of...Ch. 15 -
5. Both attenuation and riboswitches rely on...Ch. 15 - For the lac genotypes shown in the accompanying...Ch. 15 -
7. For the genotypes and conditions (lactose...
Ch. 15 -
8. The locations of numerous lacI– and lacIs...Ch. 15 - Explain why catabolite repression is used in...Ch. 15 - Describe experiments that would confirm whether or...Ch. 15 - Predict the level of genetic activity of the lac...Ch. 15 - Predict the effect on the inducibility of the lac...Ch. 15 -
13. Describe the role of attenuation in the...Ch. 15 -
14. In a theoretical operon, genes A, B, C, and D...Ch. 15 - A bacterial operon is responsible for production...Ch. 15 - A marine bacterium is isolated and is shown to...Ch. 15 -
17. Why is gene regulation more complex in a...Ch. 15 -
18. List and define the levels of eukaryotic gene...Ch. 15 -
19. Distinguish between the cis-acting regulatory...Ch. 15 - Prob. 20PDQCh. 15 - Compare the control of gene regulation in...Ch. 15 - Many eukaryotic promoter regions contain CAAT...Ch. 15 -
23. What is RNA-induced gene silencing in...Ch. 15 - Although it is customary to consider...Ch. 15 - DNA methylation is commonly associated with a...Ch. 15 - The interphase nucleus appears to be a highly...Ch. 15 - It has been estimated that at least two-thirds of...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- This is a double-stranded DNA sequence—with no introns—that codes for a small protein (this is a hypothetical example: real genes are much longer and have introns). Transcription begins at the Transcription Start Site, which is the G/C base pair indicated by “TSS” and gold shading. Transcription stops at the A/T base pair marked with the arrow. (shown in image 1) 1)Which strand is the template strand for transcription? a)top b) bottom 2)What elements allowed you to identify the template strand? (Select all that apply) a)An ATG toward the 5' end ("upstream"} from the TSS b)The template strand has the 3' end on the left side. c) An ATG toward the 3' ("downstream") from the TSS d) The template strand is "read" by the polymerase from its 3' to 5' end. 3)What is the sequence of the mRNA transcribed from this gene? a) 5’GACAGACGAUGACAUCAUGCAAAUAAGAAUUUA3’ b) 5’CUGUCUGCUACUGUAGUACGUUUAUUCUUAAAU3’ c) 3’GACAGACGAUGACAUCAUGCAAAUAAGAAUUUA5’ d) 3’CUGUCUGCUACUGUAGUACGUUUAUUCUUAAAU5’ 4) Write the…arrow_forwardImagine you are going to label a gene associated with apoptosis in Symbiodiniaceae with a Yellow Fluorescent Protein (YFP). To generate the YFP, you know the pre-MRNA looks as follows: Unspliced YFP premature mRNA Сap 5' UTR Exon 1 Intron Exon 2 Intron Exon 3 3' UTR Poly-A tail If Exon 2 is also required for mRNA stability, what can be predicted from the possible spliced alternative isoforms formed? One of the isoforms will not have a poly-A tail O The alternative splicing of YFP pre-MRNA prevents 5'-capping The MRNA isoform without Exon 2 will be degraded faster than the other isoform Exon 2 will be added to isoform B later to correct the mistake in splicing The protein translated from one of the mRNA isoforms will possess an additional functional domainarrow_forwardWhat effect would inhibitors of histone deacetylases have upon transcription? Group of answer choices They would increase transcription by making the chromatin more compact They would increase transcription by making the chromatin less compact They would decrease transcription by making the chromatin more compact They would decrease transcription by making the chromatin less compact For this question, we will consider a eukaryotic mRNA that has four exons (E1, E2, E3, E4) and three introns (I1, I2, I3). What could occur if a protein were to bind over the 3' splice site of intron 2 (I2)? Group of answer choices The processed mRNA would consist of: E1+E2+E3+E4 The processed mRNA would consist only of: E1+E3 The processed mRNA would consist only of: E3+E4 The processed mRNA would consist of: E1+E2+E4arrow_forward
- Consider this list (below) of steps involved in transcription. These steps are out of order. TRANSCRIPTION: 1. mRNA travels through a nuclear pore and enters the cytoplasm 2. the mRNA polymerase attaches at the start of a specific gene 3. RNA polymerase reads the gene surface4. a transcription factor bonds to a promoter site5. DNA molecule is unwound 6. a complimentary mRNA is produced What is the correct order of this transcription?arrow_forwardThe human rhodopsin gene is 2675 nucleotides long from transcription start site to transcription stop site. The human rhodopsin protein is 348 amino acids. What is the length of the mature mRNA (starting at the start codon and ending at the stop codon) from which the rhodopsin protein is synthesized? Explain how you reached your answer, including information about introns, exons, and splicing.arrow_forwardThis diagram shows a double-stranded section of DNA. The arrow indicates location and strand of the transcription start site. The direction of transcription is also indicated. In which box would you find a 5’TATAA \3’ promoter sequence that would be used for initiating transcription at the start site shown? a) Box A b) Box B c) Box C d) Box Darrow_forward
- Transcription factors function in the nucleus. However, like (almost) all eukaryotic proteins,they are translated in the cytosol. Can you draw a visual to explain how transcription factor proteinsenter the nucleus from the cytoplasm? Can you also include a representation of relevant proteins and proteindomains to explain how these proteins reach their destination. Thank youarrow_forwardThe diagram below depicts an active transcription bubble after a short period of RNA synthesis during the transcription process of a prokaryotic gene. Redraw the diagram and label parts (i) to (v) on the diagram. Motivate your answers. (i) the template and the non-template strands; (ii) the orientation (direction) of both DNA strands and that of the newly synthesised RNA strand; (iii) the location of a possible promotor sequence; (iv) the location of a possible Shine-Dalgarno sequence; (v) the specific area of activity of a RNA polymerase.arrow_forwardIf there is a three base pair insertion into the cxx3 gene in the location marked by the whitearrowhead, what difference (if any) would you expect to see in Cxx3 protein produced by CD4+ Tcells with this variant gene? Explain.arrow_forward
- Define both transcription and translation. In addition, describe the role(s) of each of the following in the processes of gene expression and protein synthesis: DNA, mRNA, tRNA, rRNA, ribosome(s), RNA polymerase, codon, anticodon, amino acid(s) and polypeptide(s). Be detailed in your answer.arrow_forwardGive only typing answer with explanation and conclusionarrow_forwardATM is a kinase that phosphorylates histone H2AX in response to double-stranded DNA breaks. Which of the following scenarios would most quickly regulate ATM activity in the cell? a) Adding silencing methyl groups to cytosines in the Atm gene b) Modifying the histone code for the Atm gene c) Increasing expression of a miRNA specific for the Atm mRNA d) Activating an E3 ubiquitin ligase specific for the ATM proteinarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY