
Concept explainers
Whale skeletons contain nonfunctional pelvic bones
- a. as a result of convergent evolution.
- b. due to catastrophism.
- c. because whales evolved from ancestors that had hind legs.
- d. because the bones might be needed for a future adaptation.

Introduction:
Evolution is a process of changes occurring in the heritable characters of living organisms over the period of time from generation to generation. In evolutionary studies, it is observed that some of the sequences from the genetic makeup of an early ancestor are reflected in their generation of related species. This proved that the genetic information is inherited from ancestors to their generations to pass the important traits or genes.
Answer to Problem 1MC
Correct answer:
Vestigial structures are those structures which lost functionality through time. They were evolved in ancestors to perform different functions but lost functionality in recent species. Pelvic bones in whales is an example of a vestigial structure that shows the evolution of four-legged ancestors to aquatic species with shrunken hind legs. The ancestors had fully functional pelvic bones which played important role in their terrestrial habitat but it lost functionality as whale evolved from terrestrial to aquatic habitats. Therefore, option (c) is correct.
Option (c) is given as “because whales evolved from ancestors that had hind legs”.
Explanation of Solution
Justify reason for the correct statement:
Whale skeleton contains nonfunctional pelvic bones as their ancestors who were land dwellers had hind legs. Hind legs were functional for land-dwelling ancestors but later with time as whales occupied aquatic habitats, the hind legs became nonfunctional. These structures which get nonfunctional through time due to change in habitats or due to reduced use of these structures are known as vestigial structures.
Hence, option (c) is correct.
Justify reasons for the incorrect statements:
Option (a) is given as “as a result of convergent evolution”.
Different species having similar adaptations or structures due to similar environmental conditions show convergent evolution. Whales do not have nonfunctional structures due to convergent evolution. Hence, it is a wrong answer.
Option (b) is given as “due to catastrophism”.
Catastrophism is the evolutionary change that occurs due to sudden environmental changes. Whales do not have nonfunctional structures due to catastrophism. Hence, it is a wrong answer.
Option (d) is given as “because the bones might be needed for a future adaptation”
Vestigial structures do not develop for the future needs or requirement in a species thus whales do not have nonfunctional structures for future adaptation. Hence, it is a wrong answer.
Hence, options (a), (b), and (d) are incorrect.
Vestigial structures are those structures that become nonfunctional due to loss of functionality or loss of its use. The ancestors of whales were land dwellers but as their species shifted to aquatic habitats their use of hind legs got reduced and became nonfunctional that is why whales have nonfunctional pelvic bones.
Want to see more full solutions like this?
Chapter 15 Solutions
Biology: Life on Earth with Physiology (11th Edition)
- Don't copy the other answerarrow_forward4. Aerobic respiration of 5 mM acetate solution. Assume no other carbon source and that acetate is equivalent to acetyl-CoA. NADH FADH2 OP ATP SLP ATP Total ATP Show your work using dimensional analysis here: 5. Aerobic respiration of 2 mM alpha-ketoglutaric acid solution. Assume no other carbon source. NADH FADH2 OP ATP Show your work using dimensional analysis here: SLP ATP Total ATParrow_forwardBiology You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?arrow_forward
- Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.arrow_forwardAwnser these Discussion Questions Answer these discussion questions and submit them as part of your lab report. Part A: The Effect of Temperature on Enzyme Activity Graph the volume of oxygen produced against the temperature of the solution. How is the oxygen production in 30 seconds related to the rate of the reaction? At what temperature is the rate of reaction the highest? Lowest? Explain. Why might the enzyme activity decrease at very high temperatures? Why might a high fever be dangerous to humans? What is the optimal temperature for enzymes in the human body? Part B: The Effect of pH on Enzyme Activity Graph the volume of oxygen produced against the pH of the solution. At what pH is the rate of reaction the highest? Lowest? Explain. Why does changing the pH affect the enzyme activity? Research the enzyme catalase. What is its function in the human body? What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…arrow_forwardAnwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forward
- How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forward
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
- Comprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning





