The way in which a gene in a multicellular organism may produce different products in different types of cells. Introduction: In eukaryotes, transcription occurs in the nucleus, and pre-mRNA is synthesized. This pre-mRNA is further modified before translation in the cytoplasm. This is known as RNA processing. It includes the modification of mRNA ends and RNA splicing. During RNA splicing, the non-coding regions, that is introns, are excised from the RNA molecules, and the coding regions are joined.

Question

Want to see the full answer?

Answer 1

Question

Chapter 14.3, Problem 9LO

Summary Introduction

To explain: The way in which a gene in a multicellular organism may produce different products in different types of cells.

Introduction: In eukaryotes, transcription occurs in the nucleus, and pre-mRNA is synthesized. This pre-mRNA is further modified before translation in the cytoplasm. This is known as RNA processing. It includes the modification of mRNA ends and RNA splicing. During RNA splicing, the non-coding regions, that is introns, are excised from the RNA molecules, and the coding regions are joined.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks

Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?

What is amplification bias?

Answer 2

Question

Chapter 14.3, Problem 9LO

Summary Introduction

To explain: The way in which a gene in a multicellular organism may produce different products in different types of cells.

Introduction: In eukaryotes, transcription occurs in the nucleus, and pre-mRNA is synthesized. This pre-mRNA is further modified before translation in the cytoplasm. This is known as RNA processing. It includes the modification of mRNA ends and RNA splicing. During RNA splicing, the non-coding regions, that is introns, are excised from the RNA molecules, and the coding regions are joined.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 3

Question

Chapter 14.3, Problem 9LO

Summary Introduction

To explain: The way in which a gene in a multicellular organism may produce different products in different types of cells.

Introduction: In eukaryotes, transcription occurs in the nucleus, and pre-mRNA is synthesized. This pre-mRNA is further modified before translation in the cytoplasm. This is known as RNA processing. It includes the modification of mRNA ends and RNA splicing. During RNA splicing, the non-coding regions, that is introns, are excised from the RNA molecules, and the coding regions are joined.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 4

Question

Chapter 14.3, Problem 9LO

Summary Introduction

To explain: The way in which a gene in a multicellular organism may produce different products in different types of cells.

Introduction: In eukaryotes, transcription occurs in the nucleus, and pre-mRNA is synthesized. This pre-mRNA is further modified before translation in the cytoplasm. This is known as RNA processing. It includes the modification of mRNA ends and RNA splicing. During RNA splicing, the non-coding regions, that is introns, are excised from the RNA molecules, and the coding regions are joined.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 5

Chapter 14.3, Problem 9LO

Summary Introduction

To explain: The way in which a gene in a multicellular organism may produce different products in different types of cells.

Introduction: In eukaryotes, transcription occurs in the nucleus, and pre-mRNA is synthesized. This pre-mRNA is further modified before translation in the cytoplasm. This is known as RNA processing. It includes the modification of mRNA ends and RNA splicing. During RNA splicing, the non-coding regions, that is introns, are excised from the RNA molecules, and the coding regions are joined.

Answer 6

Chapter 14.3, Problem 9LO

Summary Introduction

To explain: The way in which a gene in a multicellular organism may produce different products in different types of cells.

Introduction: In eukaryotes, transcription occurs in the nucleus, and pre-mRNA is synthesized. This pre-mRNA is further modified before translation in the cytoplasm. This is known as RNA processing. It includes the modification of mRNA ends and RNA splicing. During RNA splicing, the non-coding regions, that is introns, are excised from the RNA molecules, and the coding regions are joined.

Answer 7

Chapter 14.3, Problem 9LO

Summary Introduction

To explain: The way in which a gene in a multicellular organism may produce different products in different types of cells.

Introduction: In eukaryotes, transcription occurs in the nucleus, and pre-mRNA is synthesized. This pre-mRNA is further modified before translation in the cytoplasm. This is known as RNA processing. It includes the modification of mRNA ends and RNA splicing. During RNA splicing, the non-coding regions, that is introns, are excised from the RNA molecules, and the coding regions are joined.

Answer 8

Expert Solution & Answer

Answer 9

Expert Solution & Answer

Answer 10

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 11

Ch. 14.1 - Explain why bacterial and eukaryotic cells have...Ch. 14.1 - Prob. 1C Ch. 14.1 - Prob. 2C Ch. 14.2 - Prob. 2LO Ch. 14.2 - Distinguish among inducible, repressible, and...Ch. 14.2 - Differentiate between positive and negative...Ch. 14.2 - Prob. 5LO Ch. 14.2 - Prob. 1C Ch. 14.2 - What structural features does the trp operon share...Ch. 14.2 - Prob. 3C

Solution Summary: The author explains the process of RNA processing in eukaryotes, where pre-mRNA is synthesized and modified before translation in the cytoplasm. Alternate splicing produces different proteins by

Concept explainers

Videos

Want to see the full answer?

Chapter 14 Solutions