
Seeley's Anatomy & Physiology
11th Edition
ISBN: 9780077736224
Author: Cinnamon VanPutte, Jennifer Regan, Andrew F. Russo Dr., Rod R. Seeley Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 14.1, Problem 7AYP
Summary Introduction
To analyze:
Spinocerebellar tract and its subparts; anterior and posterior spinocerebellar tracts.
Introduction:
Spinocerebellar tract is a nerve tract that extends from the spinal cord to the cerebellum. It carries afferent information from the joints, muscles, aponeurosis, tendons, and muscle spindle via the spinal cord.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups?
Loci
a and b
Percent Recombination
50
a and c
14
a and d
10
a and e
50
a and f
50
b and c
50
b and d
50
b and e
35
b and f
20
c and d
5
c and e
50
c and f
50
d and e
50
d and f
50
18
e and f
Selected Answer:
n6
Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances.
Z
e.g. Linkage group 1=P____5 mu__Q____12 mu
R
38 mu
5 Linkage group 2-X_____3 mu__Y_4 mu
sanight
Chapter 14 Solutions
Seeley's Anatomy & Physiology
Ch. 14.1 - In general, into what three groups con sensory...Ch. 14.1 - List the eight major types of sensory receptors,...Ch. 14.1 - Prob. 3AYPCh. 14.1 - Prob. 4AYPCh. 14.1 - Prob. 5AYPCh. 14.1 - Prob. 6AYPCh. 14.1 - Prob. 7AYPCh. 14.1 - How do descending pathways modulate sensation?Ch. 14.1 - Prob. 9AYPCh. 14.1 - Describe the spatial organization of the general...
Ch. 14.1 - Prob. 11AYPCh. 14.2 - Prob. 12AYPCh. 14.2 - Prob. 13AYPCh. 14.2 - Prob. 14AYPCh. 14.2 - Prob. 15AYPCh. 14.2 - What two tracts form the direct pathways? What...Ch. 14.2 - Describe the location of the neurons in each...Ch. 14.2 - Name the structures and tracts that form the...Ch. 14.2 - Prob. 19AYPCh. 14.2 - Prob. 20AYPCh. 14.2 - What are the three functional parts of the...Ch. 14.2 - Explain the comparator activities of the...Ch. 14.2 - What are the general symptoms of cerebellar...Ch. 14.3 - Prob. 24AYPCh. 14.3 - Prob. 25AYPCh. 14.3 - Discuss the somatic motor output and reflexes from...Ch. 14.3 - Prob. 27AYPCh. 14.3 - Prob. 28AYPCh. 14.4 - Prob. 29AYPCh. 14.4 - Prob. 30AYPCh. 14.4 - Prob. 31AYPCh. 14.4 - Prob. 32AYPCh. 14.4 - What conditions produce alpha, beta, theta. and...Ch. 14.4 - Prob. 34AYPCh. 14.4 - Prob. 35AYPCh. 14.4 - Prob. 36AYPCh. 14.4 - Distinguish between declarative and procedural...Ch. 14.4 - Prob. 38AYPCh. 14.4 - Prob. 39AYPCh. 14.5 - Prob. 40AYPCh. 14.5 - Prob. 41AYPCh. 14.5 - Does aging always produce memory loss?Ch. 14 - Prob. 1RACCh. 14 - Prob. 2RACCh. 14 - Prob. 3RACCh. 14 - Prob. 4RACCh. 14 - Prob. 5RACCh. 14 - Prob. 6RACCh. 14 - Prob. 7RACCh. 14 - Prob. 8RACCh. 14 - Tertiary neurons in both the spinothalamic tract...Ch. 14 - Prob. 10RACCh. 14 - Prob. 11RACCh. 14 - Prob. 12RACCh. 14 - Prob. 13RACCh. 14 - Prob. 14RACCh. 14 - Prob. 15RACCh. 14 - Prob. 16RACCh. 14 - Prob. 17RACCh. 14 - Prob. 18RACCh. 14 - Which of these pathways is not an indirect...Ch. 14 - Prob. 20RACCh. 14 - The major effect of the basal nuclei is a. to act...Ch. 14 - Which part of the cerebellum is correctly matched...Ch. 14 - Prob. 23RACCh. 14 - Prob. 24RACCh. 14 - Prob. 25RACCh. 14 - The main connection between the right and left...Ch. 14 - Prob. 27RACCh. 14 - Prob. 28RACCh. 14 - Prob. 29RACCh. 14 - Prob. 30RACCh. 14 - Describe all the sensations and perceptions...Ch. 14 - Prob. 2CTCh. 14 - Prob. 3CTCh. 14 - Prob. 4CTCh. 14 - Prob. 5CTCh. 14 - Prob. 6CTCh. 14 - Prob. 7CTCh. 14 - Prob. 8CTCh. 14 - Prob. 9CT
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
- Principles Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage LearningSurgical Tech For Surgical Tech Pos CareHealth & NutritionISBN:9781337648868Author:AssociationPublisher:CengageConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning
Surgical Tech For Surgical Tech Pos Care
Health & Nutrition
ISBN:9781337648868
Author:Association
Publisher:Cengage

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
The Sensorimotor System and Human Reflexes; Author: Professor Dave Explains;https://www.youtube.com/watch?v=M0PEXquyhA4;License: Standard youtube license