Campbell Biology in Focus
Campbell Biology in Focus
3rd Edition
ISBN: 9780134710679
Author: Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Rebecca Orr
Publisher: PEARSON
bartleby

Concept explainers

bartleby

Videos

Textbook Question
Book Icon
Chapter 14.1, Problem 3CC

DRAW IT The template strand of a gene contains the sequence 3’-TTCAGTCGT-5’. Suppose that the nontemplate sequence could be transcribed instead of the template sequence. Draw the nontemplate sequence in 3’ to 5’ order. Then draw the mRNA sequence and translate it using Figure 14.6Q. (Be sure to pay attention to the 5’ and 3’ ends, remembering that the mRNA is antiparallel to the DNA strand.) Predict how well the protein synthesized from the nontemplate strand would function, if at all

Blurred answer
Students have asked these similar questions
Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.
You are given the following mRNA sequence. You know that it contains some UTR sequence and the beginning of the coding sequence of a gene. 5’ ACGGUAUCUAUGGAUUCUGAGGUUGCUGCUUUGGUUAUU 3’ Part A: Write the amino acid sequence for this portion of the coding sequence. Part B: Write the double-stranded DNA sequence that corresponds to the mRNA above. Label 5’ and 3’ ends. Would transcription have occurred using the top or bottom strand as the template?
The DNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U A G U UUU1 UUC UUA LOU Leu CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala CAU His CAC CAA CAG Gin AAU Asn AAC AAA 1 Lys AAG LYS G {}a UAA Stop UGA Stop A UAG Stop UGG Trp GAU 1 GAC Asp GAA GIU Glu GAGJ UGU UGC CGU CGC CGA CGG AGU AGC AGA AGG Cys GGU GGC GGA GGG Arg Ser Arg DOA DOA DOA DUTO Third letter Gly

Chapter 14 Solutions

Campbell Biology in Focus

Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Text book image
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Text book image
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY