BIOLOGY
12th Edition
ISBN: 9781260169614
Author: Raven
Publisher: RENT MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 14, Problem 7U
Which of the following is NOT pan of the Watson-Crick model of the structure of DNA?
a. DNA is composed of two strands.
b. The two DNA strands are oriented in parallel (5′-to-3′).
c. Purines bind to pyrimidines.
d. DNA forms a double helix.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
In the Watson-Crick structure of DNA, the:
a. adenine content of one strand must equal the thymine content of the same strand.
b. nucleotides are arranged in the A-form.
c. purine content (fraction of bases that are purines) must be the same in both strands.
d. two strands are parallel.
e. the strands are complementary to each other.
The following is diagram of a generalized tetranucleotide. Carbons exist at corners on the shapes and phosphate
groups are filled circles.
A. Is this a DNA or an RNA Molecule?
B. Where is the 3’ end of this tetranucleotide?
C. Given that the DNA strand which served as a template for the synthesis of this
tetranucleotide was composed of the bases 5’-ACAG-3’, where are the expected bases?
Which of the following statement for the B-DNA helix is NOT true?
a.
It is a left-handed helix.
b.
Planes of bases are nearly perpendicular to the helix axis.
c.
Sugars are in the 2’-endo conformation.
d.
Bases are in the anti conformation.
e.
It is a common form of duplex DNA solution.
Chapter 14 Solutions
BIOLOGY
Ch. 14.1 - Describe the experiments of Griffith and Avery.Ch. 14.1 - Evaluate the evidence for DNA as genetic material.Ch. 14.2 - Explain how the WatsonCrick structure rationalized...Ch. 14.2 - Prob. 2LOCh. 14.3 - Prob. 1LOCh. 14.3 - Prob. 2LOCh. 14.4 - Prob. 1LOCh. 14.4 - Prob. 2LOCh. 14.4 - Diagram the functions found at the replication...Ch. 14.5 - Compare eukaryotic replication with prokaryotic.
Ch. 14.5 - Prob. 2LOCh. 14.5 - Prob. 3LOCh. 14.6 - Prob. 1LOCh. 14.6 - Prob. 2LOCh. 14 - Prob. 1DACh. 14 - Prob. 2DACh. 14 - Prob. 1IQCh. 14 - Prob. 2IQCh. 14 - How does the structure of eukaryotic genomes...Ch. 14 - Prob. 4IQCh. 14 - Prob. 1UCh. 14 - Which of the following is NOT a component of DNA?...Ch. 14 - Chargaff studied the composition of DNA from...Ch. 14 - The bonds that hold two complementary strands of...Ch. 14 - Prob. 5UCh. 14 - Prob. 6UCh. 14 - Which of the following is NOT pan of the...Ch. 14 - If one strand of a DNA is 5 ATCGTTAAGCGAGTCA 3,...Ch. 14 - Hershey and Chase used radioactive phosphorus and...Ch. 14 - The Meselson and Stahl experiment used a density...Ch. 14 - Prob. 4ACh. 14 - If the activity of DNA ligase was removed from...Ch. 14 - Successful DNA synthesis requires all of the...Ch. 14 - The synthesis of telomeres a. uses DNA polymerase,...Ch. 14 - When mutations that affected DNA replication were...Ch. 14 - Prob. 1SCh. 14 - In the Meselson-Stahl experiment, a control...Ch. 14 - Enzyme function is critically important for the...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which of the following is/are true about the two DNA strands that form a helix? (check all that apply) Select one or more: a.The 2 strands are antiparallel and complementary to each other b.The 2 strands are linked to each other by phosphodiester bonds c.The phosphate groups of nucleotides impart a negative charge to nucleic acidsarrow_forwardEnzymes that break down DNA catalyze the hydrolysis of the covalent bonds that join nucleotides together. What would happen to DNA molecules treated with these enzymes? Group of answer choices A. All bases would be separated from the deoxyribose sugars B. The purines would be separated from the deoxyribose sugars C. The phosphodiester linkages between deoxyribose sugars would be broken D. The two strands of the double helix would separate E. The pyrimidines would be separated from the deoxyribose sugarsarrow_forwardWhich of the following substances is involved in de novo synthesis of purine nucleotides but not pyrimidine nucleotides () A, glutamine B, glutamate C, aspartic acid D, glycine What is wrong with the statement about the B-type DNA double helix model is that () A, the base plane and the pentose plane are perpendicular to each other B. The base plane is located outside the helix C. The two chains are stabilized by interbase hydrogen bonding D. is a right-handed spiral structure The enzymes in common with the following enzymes that catalyze glycolysis and gluconeogenesis are () A, hexokinase B, phosphoglycerate kinase C, 1, 6-2p-fructokinase and D, pyruvate kinase Which of the following enzyme catalyzed reactions does not involve the production or consumption of carbon dioxide () A, pyruvate carboxylase B, isocitrate dehydrogenase C, 6-P-gluconate dehydrogenase and D, succinate dehydrogenasearrow_forward
- Here is the cartoon representation and Ramachandran plot of a small DNA-binding protein, 80-residues in length. In its Ramachandran plot, 58 residues fall in the a region; 20 residues fall in the region; 2 residues fall in the L region. No residues fall in the disallowed region. The polypeptide termini are labelled. 11. Approximately what percentage of the protein is a-helix? A. 38% B. 42% C. 58% D. 72% 12. What percentage of the protein is B-sheet? A. 0% B. 25% C. 75% D. 100% 13. What percentage of the protein is regular structure? A. 3% B. 42% C. 58% D. 97% 14. What percentage of the protein is irregular structure? A. 0% B. 42% C. 75% D. 97% 15. How many domains are present? A. 1 B. 2 C. 3 D. 4 100 16. How many subunits are present? A. 1 B. 2 C. 3 D. 4arrow_forwardIdentify the statements that describe the structure of DNA. (select all that are correct) A. A DNA double helix contains two sugar‑phosphate backbones oriented in opposite directions. B. Adenine is paired with thymine, and guanine is paired with cytosine. C. Adenine is paired with cytosine, and guanine is paired with thymine. D. The five‑carbon sugar of DNA is called ribose. E. The five‑carbon sugar of DNA is called deoxyribose.arrow_forwardFor entertainment on a Friday night, a genetics professor proposed that his children diagram a polynucleotide strand of DNA. Having learned about DNA in preschool, his 5-year-old daughter was able to draw a polynucleotide strand, but she made a few mistakes. The daughter’s diagram (represented here) contained at least 10 mistakes. a. Make a list of all the mistakes in the structure of this DNA polynucleotide strand. b. Draw the correct structure for the polynucleotide strand.arrow_forward
- Suppose the following base sequence was found in a 20-base DNA polymer. 3'CAGTTACGGCTCCTAGGTTATAATTCGTTTC 5' a. What would be the first 5 bases at the 3' end of the complementary strand? b. What would be the first 10 bases at the 5' end of the complementary strand? c. Assuming the presence of the complementary strand, what is the percentage composition of the polymer with respect to the A-T base pair? with respect to the G-C base pair? d. In the given segment in problem 1, illustrate and indicate the direction of the synthesis of: i. a 5-nucleotide RNA primer ii. a 5-nucleotide Okazaki fragmentarrow_forwardThe original DNA base sequence is 5’-AGCGTTACCGT-3’; a mutation in the DNA strand results in the base sequence 5’-AGGCGTTACCGT-3’. What can you conclude about the mutation? A. It is a frameshift mutation. B. It is a silent mutation. C. It is a deleterious mutation. D. It may result in a single amino acid change in the protein being coded for by this base sequence.arrow_forwardIndicate whether each of the following base-pairing situations (1) involves two DNA strands, (2) involves a DNA strand and an RNA strand, or (3) could involve either two DNA strands or a DNA strand and an RNA strand? a. A G T U C A b. A C T T G A c. A G U T C A d. C G C G C G a. A G T U C A b. A C T T G A c. A G U T C A d. C G C G C Garrow_forward
- Which of the following statements is not true? Explain why. A. A DNA strand can serve as a template strand on many occasions. B. Following semiconservative DNA replication, one strand is a newly made daughter strand and the other strand is a parental strand. C. A DNA double helix may contain two strands of DNA that were made at the same time. D. A DNA double helix obeys the AT/GC rule. E. A DNA double helix could contain one strand that is 10 generations older than its complementary strand.arrow_forward8)arrow_forwardWhich of the following is true regarding the 5’ vs. the 3’ end of a strand of DNA? a) only double-stranded DNA can have a 5' and a 3' end b) 5' and 3' are designations of the carbon in the deoxyribose of a nucleotide that is not bound to another deoxyribose or phosphate group c) 5' and 3' are designations of the DNA base that is unbound to another base d) The 5' end of DNA is always considered the start of the gene and the 3' end is considered the endarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license