
Brock Biology of Microorganisms (15th Edition)
15th Edition
ISBN: 9780134261928
Author: Michael T. Madigan, Kelly S. Bender, Daniel H. Buckley, W. Matthew Sattley, David A. Stahl
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 1.4, Problem 2MQ
Summary Introduction
Microorganisms play a major role for all living beings. They are microscopic in nature and are found in air, water, and soil. They have both beneficial (nutrition and fermentation) and harmful (diseases) roles. The microorganisms are intimately associated with our daily need as foods. Fermentation of food and agricultural feedstocks with microbial source improves the quality food and prevents the spoilage.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Biology
You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Chapter 1 Solutions
Brock Biology of Microorganisms (15th Edition)
Ch. 1.1 - In what ways are microorganisms important to...Ch. 1.1 - Why are microbial cells useful for understanding...Ch. 1.1 - What is a microbial colony and how is one formed?Ch. 1.1 - What are bacterial colonies and how are they...Ch. 1.2 - What structures are universal to all types of...Ch. 1.2 - Prob. 2MQCh. 1.2 - What structures can be used to distinguish between...Ch. 1.2 - Prob. 1CRCh. 1.3 - How old is Earth and when did cells first appear...Ch. 1.3 - Prob. 2MQ
Ch. 1.3 - Why were cyanobacteria so important in the...Ch. 1.3 - Prob. 1CRCh. 1.4 - Prob. 1MQCh. 1.4 - Prob. 2MQCh. 1.4 - Prob. 3MQCh. 1.4 - Prob. 1CRCh. 1.5 - Define the terms magnification and resolution.Ch. 1.5 - Prob. 2MQCh. 1.5 - Prob. 1CRCh. 1.6 - Prob. 1MQCh. 1.6 - Prob. 2MQCh. 1.6 - How can cells be made to fluoresce?Ch. 1.6 - Prob. 1CRCh. 1.7 - Prob. 1MQCh. 1.7 - Prob. 2MQCh. 1.7 - Prob. 1CRCh. 1.8 - Prob. 1MQCh. 1.8 - Prob. 2MQCh. 1.8 - Prob. 1CRCh. 1.9 - Prob. 1MQCh. 1.9 - Prob. 2MQCh. 1.9 - Besides ending the controversy over spontaneous...Ch. 1.9 - Explain the principle behind the Pasteur flask in...Ch. 1.10 - How do Kochs postulates ensure that cause and...Ch. 1.10 - What advantages do solid media offer for the...Ch. 1.10 - Prob. 3MQCh. 1.10 - Prob. 1CRCh. 1.11 - What is meant by the term enrichment culture?Ch. 1.11 - Prob. 2MQCh. 1.11 - What were the major microbiological interests of...Ch. 1.12 - Describe the experiments that proved DNA was the...Ch. 1.12 - Why are microbial cells useful tools for basic...Ch. 1.12 - Describe the experiments that proved DNA to be the...Ch. 1.13 - What kinds of evidence support the three-domain...Ch. 1.13 - What is a phylogenetic tree?Ch. 1.13 - List three reasons why rRNA genes are suitable for...Ch. 1.13 - What insights led to the reconstruction of the...Ch. 1.14 - How are viruses different from Bacteria, Archaea,...Ch. 1.14 - What four bacterial phyla contain the most...Ch. 1.14 - Prob. 3MQCh. 1.14 - What features (or lack of features) can be used to...Ch. 1 - Pasteurs experiments on spontaneous generation...Ch. 1 - Describe the lines of proof Robert Koch used to...Ch. 1 - Imagine that all microorganisms suddenly...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Comprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage LearningBasic Clinical Lab Competencies for Respiratory C...NursingISBN:9781285244662Author:WhitePublisher:Cengage

Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning
Basic Clinical Lab Competencies for Respiratory C...
Nursing
ISBN:9781285244662
Author:White
Publisher:Cengage
Industrial Processes and By-products | 9-1 GCSE Chemistry | OCR, AQA, Edexcel; Author: SnapRevise;https://www.youtube.com/watch?v=CMLKgqEMXwc;License: Standard Youtube License