Introduction:
Nociceptors are the sensory neurons and are located in the deep structures of the body. The signals produced by these receptors in deep body tissues are biologically as well as clinically important.

Answer to Problem 1RAC
The correct answer is option (c) painful mechanical, chemical, or thermal stimuli.
Explanation of Solution
Explanation for the correct answer:
Option (c) painful mechanical, chemical, or thermal stimuli. Nociceptors are the neurons that sense the pain and respond to potentially damaging stimuli. These neurons respond to stimuli by transferring threat signals to the spinal cord and brain. So, the correct answer is option (c).
Explanation for incorrect answer:
Option (a) changes in temperature at the site of the receptor. Nociceptors respond to the extreme alterations in temperature that induce pain. So, this is an incorrect option.
Option (b) compression, bending, or stretching of cells. The compression, stretching of cells, or bending can stimulate the nociceptors. However, the stretching or bending outside a normal range only can cause pain. So, this is an incorrect option.
Option (d) light striking a receptor cell. The light striking a particular receptor cell must be strong enough to induce pain in order to trigger a nociceptor reaction. So, this is an incorrect option.
Nociceptors mainly respond to damaging stimuli such as painful mechanical, thermal, or
Want to see more full solutions like this?
Chapter 14 Solutions
SEELEY'S ANATOMY CUSTOM LL
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningComprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage LearningBasic Clinical Lab Competencies for Respiratory C...NursingISBN:9781285244662Author:WhitePublisher:Cengage




