Concept explainers
Introduction:
The overreactions of the immune system to some non-toxic or innocuous environmental antigens are known as the hypersensitivity reactions. These are also known as allergic reactions. Depending upon the active mechanisms these reactions are grouped into four types.

Answer to Problem 1Q
Correct answer:
The correct answer is option (c) type III hypersensitivity: modified cell-surface components.
Option (g) type II hypersensitivity: immediate hypersensitivity.
Explanation of Solution
Explanation/justification for the correct answer:
Option (c) type III hypersensitivity: modified cell-surface components. Type III hypersensitivity is usually caused by the small and soluble immune complexes of antigen-specific IgG. These are deposited in the walls of blood capillaries or the alveoli of lungs. Antibodies or other proteins are commonly derived from the non-human animal species. These are given to the patients which are prone to type III hypersensitivity reactions. So, the correct answer is option (c).
Option (g) type II hypersensitivity: immediate hypersensitivity. In this type of hypersensitivity, reactions take place immediately after the contact to the allergens. Type II hypersensitivity is also known as immediate hypersensitivity as it leads to immediate allergic reactions. So, the correct answer is option (g).
Explanation for incorrect answer:
Option (a) type I hypersensitivity: mast cells, basophils, and eosinophils. These hypersensitivity reactions are started by the infection of an allergic-antigen with the allergen-specific IgE. These are linked to FceRI receptors of mast cells, basophils, and eosinophils. So, this is an incorrect option.
Option (b) type II hypersensitivity: Penicillin allergy. It is a type of hypersensitivity reactions which is caused by an IgG response to some chemical and small molecules. These are covalently bound to the outside surface of the cells. So, this is an incorrect answer.
Option (d) type IV hypersensitivity:CD4 TH1 or CD8 T-cells. These reactions are usually caused by the antigen-specific effector T-cells like CD4 TH1 cells or CD8 T-cells. So, this is an incorrect answer.
Option (e) type III hypersensitivity: non-human therapeutic proteins. Antibodies which are derived from the non-human animal species are usually given to patients. These induce type III hypersensitivity reactions. So, this is an incorrect answer.
Option (f) type IV hypersensitivity: modified intracellular human proteins. These reactions are usually caused by CD4T-cells. These cells respond to the epitopes of peptides which are derived from chemically modified human proteins. The example of these proteins is nickel-modified peptides presented by MHC class II molecules. So, this is an incorrect answer.
Option (h) type I hypersensitivity: IgE cross-linking. This type of hypersensitivity is usually caused by the interaction of soluble allergens with the specific IgE. So, this is an incorrect answer.
Hence, Type III hypersensitivity is usually caused by small soluble immune complexes of antigen and specific IgG. Type II hypersensitivity is also known as immediate hypersensitivity as it leads to immediate allergic reactions. So, the correct answer is option (c) type III hypersensitivity: modified cell-surface components, option (g) type II hypersensitivity: immediate hypersensitivity.
Want to see more full solutions like this?
Chapter 14 Solutions
The Immune System (fourth Edition) Ebook Folder
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





